ID: 1034596880

View in Genome Browser
Species Human (GRCh38)
Location 7:152204709-152204731
Sequence TAGCTAAGGCAGTCAAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 2, 1: 0, 2: 1, 3: 16, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034596880 Original CRISPR TAGCTAAGGCAGTCAAAGAA AGG Intronic
902246495 1:15124375-15124397 TAGATAAGGAAGAAAAAGAATGG + Intergenic
902996009 1:20225707-20225729 TATTTATGGCAGTCAGAGAATGG - Intergenic
903770581 1:25761369-25761391 TATATAAGGCAATCAAAAAAAGG - Intronic
907110473 1:51922190-51922212 GTGATAAGGCAGTCAAAGACTGG - Intronic
907913520 1:58847892-58847914 TAGTAAAGGCAGTGAGAGAAGGG - Intergenic
910107454 1:83646841-83646863 TAGCTAAGGAGGCAAAAGAAAGG - Intergenic
910797361 1:91111916-91111938 TAGCTAAAGCAATCAGATAAGGG + Intergenic
910832280 1:91473153-91473175 TCCCTGAGGCAATCAAAGAAGGG - Intergenic
910906087 1:92180447-92180469 AATCTAAATCAGTCAAAGAAAGG + Exonic
911124497 1:94328223-94328245 TAGCTAAGTCATTCAAAAGAAGG + Intergenic
911895743 1:103432888-103432910 TACCTAGGGCAGTGATAGAAAGG + Intergenic
913471227 1:119188797-119188819 TATTTAAAGCACTCAAAGAAAGG - Intergenic
916498182 1:165364254-165364276 TGGCTAATGAATTCAAAGAAAGG + Intergenic
918903722 1:190461800-190461822 TAGCTTTGGCAGTTGAAGAAAGG + Intronic
919474426 1:198017069-198017091 TAGCTCAAGCAGTCAAACAGAGG + Intergenic
920291884 1:204929185-204929207 TAGCCAAGGCAGGGAAAGACAGG + Intronic
920784389 1:209026824-209026846 TTGCAAAGGAACTCAAAGAAGGG - Intergenic
921238820 1:213155237-213155259 TAGCTGAGGCAGTCAAGGGAGGG - Intronic
922366007 1:224864424-224864446 TAGATAAGGTACTAAAAGAAAGG + Intergenic
923019595 1:230152855-230152877 AAGCAAAGGAAGTCCAAGAAAGG - Intronic
1063660170 10:8030041-8030063 AAGCTGAGCCAGTCTAAGAATGG - Intergenic
1063925940 10:10977511-10977533 CAGGAAAGACAGTCAAAGAAGGG - Intergenic
1067740583 10:48892942-48892964 TTGCTAGGGCAGTCAAAAACTGG + Intronic
1071612952 10:87048214-87048236 TTGTTAAGGTAGTCAAAGCATGG - Intergenic
1071637761 10:87273182-87273204 TAGCTAAGGCAGTGTTAAAAGGG + Intergenic
1071657483 10:87464768-87464790 TAGCTAAGGCAGTGTTAAAAGGG - Intergenic
1073773347 10:106759685-106759707 GAACTGAGGCAGTTAAAGAAAGG + Intronic
1074368284 10:112877824-112877846 GGGCTAAGGCAGTTATAGAAAGG - Intergenic
1075352130 10:121733579-121733601 CAGTTAAGGGAGCCAAAGAAAGG - Intergenic
1079699831 11:23530945-23530967 TAGCTAAAATAGTCAAATAATGG - Intergenic
1080834787 11:35930049-35930071 TAACTATGGCTGTCATAGAATGG - Intergenic
1082671412 11:56040885-56040907 CAGCTAAGGGAGTTAAAAAAGGG + Intergenic
1082875697 11:57986068-57986090 TAGCTAAGGAAGTCAAGAAAGGG - Intergenic
1085226003 11:74921744-74921766 TAGATAAAGCAGTCAAAGTTAGG - Intronic
1086133932 11:83428027-83428049 AAGTAAAGGCAGTAAAAGAAGGG + Intergenic
1087230565 11:95657051-95657073 TAGCTAAGGTAGTTCAAGCAAGG - Intergenic
1090486091 11:127113297-127113319 CAGATAAGGAAGCCAAAGAAGGG + Intergenic
1096324196 12:50643859-50643881 TTGCTACGCCAGTCATAGAAAGG + Intronic
1096427987 12:51520591-51520613 CAGCTAATGCTGTCCAAGAATGG + Intergenic
1096482972 12:51954711-51954733 AAACTGAGGCAGTCACAGAAAGG - Intronic
1096700890 12:53381922-53381944 TAGATAAGGAAGTAAGAGAATGG + Intronic
1099053985 12:77814554-77814576 AAGCAGAGGCAGTTAAAGAAGGG + Intergenic
1102627538 12:114247448-114247470 TAGATAAGACAGTCAAACAAAGG + Intergenic
1102701304 12:114841870-114841892 TAGAGAAGGCAGGTAAAGAAAGG - Intergenic
1104179807 12:126368357-126368379 TAGAAAAGGAAGTCACAGAAGGG + Intergenic
1106197863 13:27509533-27509555 TAGCTGAGGGACCCAAAGAATGG - Intergenic
1106915336 13:34507608-34507630 TAGCTAAGGAAGTCAGCGAAGGG - Intergenic
1107565670 13:41601462-41601484 TAGCCAAAGCAATCAGAGAAAGG + Intronic
1111480552 13:88819902-88819924 AAACTATGGCAGACAAAGAAGGG + Intergenic
1112822800 13:103355874-103355896 TACTTAAGGAAGTCAAAGAGAGG + Intergenic
1113101885 13:106729223-106729245 TAGCTGAGGAAGTGAAAGGAGGG - Intergenic
1114227423 14:20751891-20751913 TTCCTAGGGCAGTCAAACAAGGG - Intergenic
1116496403 14:45565919-45565941 TAGCTACTGAAGTCATAGAAGGG - Intergenic
1118970650 14:70634434-70634456 GAGATGAGGCAGTCAGAGAATGG + Intergenic
1119034673 14:71219478-71219500 TTACTAAGGGAGTAAAAGAATGG + Intergenic
1120366177 14:83573218-83573240 TAGTTATGGAAGTCAAAGTATGG - Intergenic
1122816151 14:104315105-104315127 TAGCTAAGGGAGTGAAAGAGTGG + Intergenic
1124599440 15:31119915-31119937 TAGAGAAGGCAGAAAAAGAAGGG + Intronic
1126451291 15:48811557-48811579 TATCTAAGGCTGTTAAATAATGG - Intergenic
1127591115 15:60424482-60424504 TAGCTCACACAGTCAAAGAGAGG + Intronic
1127970184 15:63952531-63952553 GGGCTAAGGCAGTGCAAGAAAGG + Intronic
1133131013 16:3676143-3676165 GAACTAAGGCAGGCAAAGAAAGG + Exonic
1135658523 16:24273409-24273431 AAGCTAAGACAGTCTACGAAAGG - Intronic
1137993494 16:53184269-53184291 TAGATATGGCACTAAAAGAAAGG + Intronic
1138916486 16:61471208-61471230 CAGCTAAGGCAGCTAAGGAAGGG + Intergenic
1140937580 16:79688709-79688731 CAGCTAAGCTAGTCAAAGAGAGG + Intergenic
1144163796 17:12587485-12587507 AAGGTAAGGAAATCAAAGAAAGG - Intergenic
1146594206 17:34155497-34155519 GAGCTAAAGCCGTCAGAGAAGGG - Intronic
1146703853 17:34985427-34985449 TAGCTAAGGCAGTGCAAGGTGGG - Intronic
1150385883 17:64759585-64759607 TATTTTAGGAAGTCAAAGAAAGG - Intergenic
1150440595 17:65188273-65188295 GAGTTAAGGCAGAGAAAGAAAGG - Intronic
1155922682 18:31618994-31619016 TAGCTAAGGAATGGAAAGAATGG + Intergenic
1155991534 18:32283854-32283876 GTGCCATGGCAGTCAAAGAAAGG - Intronic
1156930159 18:42632126-42632148 TATCTAAGACAGTAAAAGCAGGG + Intergenic
1158100820 18:53828183-53828205 TTGCTAAAGCACGCAAAGAATGG - Intergenic
1158810644 18:61030007-61030029 TAGCTAAGTAACTCCAAGAAGGG - Intergenic
1159463352 18:68748303-68748325 TAGTTCAGGCAGTCAGACAAGGG - Intronic
1159573620 18:70148388-70148410 TATTAATGGCAGTCAAAGAAAGG + Intronic
925677695 2:6383066-6383088 CAGGAAAGGCAGTCAGAGAAGGG - Intergenic
927339452 2:21965655-21965677 GAGCTTAGGAAGTCAGAGAATGG + Intergenic
928238768 2:29568702-29568724 TAGCAGAGGTGGTCAAAGAAGGG + Intronic
928923612 2:36553485-36553507 TCCCTAGGGAAGTCAAAGAAGGG + Intronic
930614893 2:53583359-53583381 TAGCTAAGGCAGACTAGTAAGGG - Intronic
930949639 2:57124393-57124415 TAGCTGAGGCAGCCAGAGAAGGG - Intergenic
930971954 2:57407324-57407346 TATCTGAGTGAGTCAAAGAAGGG + Intergenic
931543682 2:63356764-63356786 TAGCTAAGGCAGTGTTAGGAAGG + Intronic
933099751 2:78238764-78238786 TAGTTTATGAAGTCAAAGAAAGG + Intergenic
934609865 2:95727093-95727115 GAGTTCAGGCAGTCAAAGAAGGG + Intergenic
934704056 2:96463951-96463973 TAGCAAAAGCAGGCAAGGAAGGG + Intergenic
935563137 2:104578796-104578818 GAGCTAAGACAGTCAGGGAAAGG + Intergenic
936284441 2:111171443-111171465 TACCTCAGGCAGGGAAAGAAAGG - Intergenic
936543191 2:113368666-113368688 GAGTTCAGGCAGTCAAAGAAGGG + Intergenic
936809472 2:116379944-116379966 TAGCAAAGGCAGTAACAGATAGG + Intergenic
937522668 2:122731534-122731556 TAGCTTTGGCAGTCCAATAATGG - Intergenic
939390323 2:141560503-141560525 TAGCTAAGTGAGCCAGAGAAAGG - Intronic
940159521 2:150696451-150696473 AAGATAAGCCAGTCACAGAAAGG + Intergenic
941283727 2:163583327-163583349 TAGCAAAGGCAGGCAATAAAAGG - Intergenic
941303387 2:163830582-163830604 CAGCTAGGGCAGCCAAAGGAGGG - Intergenic
941534862 2:166709439-166709461 GAAATAAGGCAGTCACAGAATGG - Intergenic
943281838 2:185944754-185944776 TAAATAAGCCAGTCATAGAAGGG + Intergenic
943433126 2:187828879-187828901 TAGCCAAGGCAGTTACAAAAAGG + Intergenic
944665428 2:201955347-201955369 TAGCAAAGGGAGTCAAATGAAGG + Intergenic
945730641 2:213528627-213528649 TTGCTCAGGCTGTCAAAGAGGGG - Intronic
1169603230 20:7286309-7286331 AAGCCATGGCATTCAAAGAATGG - Intergenic
1170208205 20:13822401-13822423 AAACTATGGAAGTCAAAGAAAGG + Intergenic
1170834741 20:19874558-19874580 AAGAGAAGGCAGCCAAAGAAAGG - Intergenic
1173072591 20:39783730-39783752 GAGCTAATGCAGTCCAACAATGG + Intergenic
1173410467 20:42805057-42805079 TATCTAAGGCAGTCCTAGGAGGG + Intronic
1174559479 20:51419871-51419893 TTGCTAAGCCAGAGAAAGAAAGG + Intronic
1174642528 20:52056847-52056869 TTGCTAAGGGAGTAAAGGAAGGG + Intronic
1176732705 21:10516809-10516831 TAGCTAAGGCAGTCAAAGAAAGG - Intergenic
1181681548 22:24498998-24499020 TGTCTAAGGCAGTCACAGCAAGG + Intronic
1181996473 22:26886742-26886764 CAGCAAAAGCAGTCATAGAATGG - Intergenic
1182798599 22:33011077-33011099 TAGCTAGGACAGTCAGATAAGGG - Intronic
1182860124 22:33552558-33552580 GAGCTGAGTCAGTCAAAGAGAGG - Intronic
951072469 3:18347887-18347909 TAACTAAAGGAGTCAAAGGATGG - Intronic
951497002 3:23340668-23340690 TTTCTAATGCAGTCCAAGAAGGG - Intronic
951609598 3:24477662-24477684 TAGCTAACGCTGCCAAAGCAAGG + Intronic
951824952 3:26858733-26858755 TAGGTAAGACAATCAATGAATGG + Intergenic
952156201 3:30646323-30646345 TAGGTAACGCTTTCAAAGAAAGG + Intronic
952211522 3:31233130-31233152 TACATAAGGGAGACAAAGAAAGG + Intergenic
952758785 3:36895314-36895336 TAGCTAAAGCAGTATAAAAAAGG + Intronic
952794095 3:37223657-37223679 TAGGAAAGGCAGCCAAATAAAGG - Intergenic
953105033 3:39869601-39869623 TGGCAATGGAAGTCAAAGAAGGG - Intronic
955861047 3:63330821-63330843 TAGCTATGGGAGTCTAGGAATGG + Intronic
956623241 3:71241659-71241681 AAGCTGAAGCAGTCGAAGAAAGG + Intronic
957175221 3:76799371-76799393 TAGCTAAAGCAATCCAACAAGGG + Intronic
957670691 3:83298010-83298032 CAGCTAAGGCAGTGAATAAAAGG + Intergenic
959677949 3:109057671-109057693 TAACTATGCCAGTCAAACAAAGG + Intronic
959948009 3:112148232-112148254 CAGATAAGGAAGTCAAAGCATGG - Intronic
961019691 3:123495145-123495167 CAGCTAAAGCAGGAAAAGAAAGG - Intronic
961526680 3:127505714-127505736 AACCTAAAGCAATCAAAGAAGGG + Intergenic
962598749 3:136974209-136974231 TAGGTAAAGCAGTCACACAAAGG - Intronic
962906379 3:139806992-139807014 GAGCTAAGACACTCAATGAATGG - Intergenic
964020159 3:152000205-152000227 TCGCTAAGGCAATAAAAGACAGG + Intergenic
965134630 3:164746581-164746603 TAGCTATGACAGCAAAAGAATGG - Intergenic
965726376 3:171720927-171720949 TAGCTCTGGGAGTCAAGGAAAGG - Intronic
966315942 3:178645498-178645520 AAGGAAAGGCAGTCAATGAAGGG + Intronic
967984997 3:195087896-195087918 TTTCAAAGGGAGTCAAAGAAAGG + Intronic
970858520 4:20675612-20675634 TAGCTAAGGAAGTTAAAGTGTGG - Intergenic
971567416 4:28162931-28162953 GAAATAAGGCAGTCACAGAAAGG - Intergenic
972226899 4:37023886-37023908 TAGATGAGGTGGTCAAAGAAAGG - Intergenic
972902435 4:43701060-43701082 CAGCTGGGGCAGTCAAGGAAGGG - Intergenic
974635530 4:64559686-64559708 GAGCTAAGGAAATCAAATAATGG - Intergenic
977967250 4:103167775-103167797 TAGCTAAGTCCTTCAAGGAATGG - Intronic
978847229 4:113287954-113287976 TAGCTAAAGCAGTAAGAGAGAGG - Intronic
983886678 4:172987965-172987987 TATTTAAAGCAGTGAAAGAATGG + Intronic
988338707 5:29940594-29940616 TAGGCAAGGCAGACATAGAAGGG + Intergenic
989504448 5:42210818-42210840 TAGCTAGGGCAATCAGACAAGGG - Intergenic
991219207 5:64193020-64193042 GAAATAAGGCAGTCACAGAAGGG + Intronic
991448437 5:66726151-66726173 TAGCTAAGGTGGTCAGGGAAGGG + Intronic
994612426 5:102060523-102060545 TATCTAAGGTAATCAATGAATGG + Intergenic
995974363 5:118013781-118013803 TAGATAAGGGAGTCAAGAAATGG - Intergenic
997102041 5:130980358-130980380 TAGCTAGGGCAGTGAGAAAAGGG - Intergenic
998249280 5:140539968-140539990 TTTTTAAGGCAGTCTAAGAAGGG - Intronic
1003393542 6:5733607-5733629 GAGCAAAGGCAGTTAAAGACTGG - Intronic
1008141547 6:47837911-47837933 TAAATAAGGCAGTGATAGAACGG - Intergenic
1008726839 6:54431847-54431869 TCACTAAGGAAGTGAAAGAAGGG + Intergenic
1008877371 6:56344126-56344148 TAGCACAGGGAATCAAAGAAAGG + Intronic
1010922965 6:81707274-81707296 TAGATAAAGCAGACAAAGAGGGG - Intronic
1013819516 6:114137728-114137750 TAGGAAAGGCAGGCAAAGAAGGG - Intronic
1013905734 6:115216200-115216222 TAGCAAAAGCAGTCCTAGAAGGG + Intergenic
1015033561 6:128625644-128625666 TATCTAAGGCACTGAAAGTAGGG + Intergenic
1016238612 6:141900223-141900245 TAGATAAAGAACTCAAAGAAAGG + Intergenic
1016430707 6:143982369-143982391 TGGCTAAAGCAGTCAGTGAAGGG + Intronic
1016763854 6:147770463-147770485 TAACTCAGTCAGTCAATGAATGG - Intergenic
1018584587 6:165342832-165342854 TAGATAAGTCAGTCAAGAAAAGG + Intronic
1018722564 6:166584063-166584085 CAGCTCAGGCAGACTAAGAAAGG - Intronic
1019567135 7:1689900-1689922 GAGCCAATGCAGTCACAGAATGG + Intronic
1021053220 7:16015054-16015076 TACCTAAACCAGCCAAAGAATGG + Intergenic
1021402914 7:20230325-20230347 TAGCTTAGGAAGTGAAAGAGCGG - Intergenic
1021945278 7:25720155-25720177 TAGTCAAGGTAGTCAAAGGATGG - Intergenic
1023035984 7:36131707-36131729 TAGCCAAGGCAGTGGAAGCAGGG + Intergenic
1023642915 7:42279136-42279158 TAAATATGGCAGACAAAGAATGG + Intergenic
1024947932 7:54830374-54830396 ATGCTAAGTCAGTCACAGAAAGG + Intergenic
1026797587 7:73376385-73376407 TAGCTCAGACAGGCACAGAATGG + Intergenic
1027732251 7:81889290-81889312 TAGGTAAGGAAGTCAAAAATTGG + Intergenic
1027996064 7:85426848-85426870 TAGCTGAGGTAGCTAAAGAAGGG + Intergenic
1028186608 7:87793827-87793849 TAGCTAGAGCAATCAGAGAAGGG + Intronic
1029980617 7:104875294-104875316 TTGACAAGGTAGTCAAAGAAAGG - Intronic
1030070903 7:105696720-105696742 TTGCTAATGCAGACAGAGAAGGG + Intronic
1030571016 7:111224456-111224478 TATCTAAGGAAGTTGAAGAAAGG + Intronic
1030608915 7:111667966-111667988 TACCTTACACAGTCAAAGAAAGG + Intergenic
1031474724 7:122207514-122207536 TAGCTCAGGAAGTTAAAAAAAGG - Intergenic
1031628683 7:124020358-124020380 TATCTAAGTCAATCAAAGAAAGG - Intergenic
1032128676 7:129212186-129212208 CAGCTGAGGCAGTCGAGGAATGG - Exonic
1034596880 7:152204709-152204731 TAGCTAAGGCAGTCAAAGAAAGG + Intronic
1037395677 8:18440025-18440047 TTCCTTAGGAAGTCAAAGAATGG - Intergenic
1038342454 8:26697936-26697958 TATATAAGGCAGTAAAACAAAGG - Intergenic
1038604296 8:28983089-28983111 TAGATATGGCAGCAAAAGAAAGG - Intronic
1039143953 8:34424119-34424141 TAGCAGATGCAGTCAAGGAAAGG - Intergenic
1040818325 8:51531776-51531798 GAGGGAAGGCATTCAAAGAAAGG + Intronic
1041457542 8:58076592-58076614 GAGCTAAGGAAGTGGAAGAATGG + Intronic
1042179597 8:66073027-66073049 TAGCCAAGGCAGTACAATAAGGG + Intronic
1042783371 8:72518333-72518355 AAGCTAAAGTGGTCAAAGAAGGG - Intergenic
1043928711 8:86066525-86066547 TAGCTAAGGATGACAGAGAATGG + Intronic
1044094959 8:88052258-88052280 GAGATAAGGCAGACACAGAAAGG - Intronic
1044942157 8:97354295-97354317 GAGCTAAGGCTGGCAGAGAAAGG - Intergenic
1045544906 8:103119838-103119860 TATCAAAGGAATTCAAAGAAGGG - Intergenic
1046613141 8:116447168-116447190 CAGAGAAGGCAGTCAAAGGAAGG - Intergenic
1052715504 9:32111431-32111453 TAGCAAAGTCAGTCTAGGAAAGG + Intergenic
1053558729 9:39166616-39166638 TAGCTCAGACAGTGAAAGCAGGG - Intronic
1053822857 9:41986851-41986873 TAGCTCAGACAGTGAAAGCAGGG - Intronic
1054138382 9:61452325-61452347 TAGCTCAGACAGTGAAAGCAGGG + Intergenic
1054607718 9:67200514-67200536 TAGCTCAGACAGTGAAAGCAGGG + Intergenic
1056453985 9:86742969-86742991 TTGCTAAGGTAGGAAAAGAAAGG - Intergenic
1057280730 9:93709242-93709264 TAGATAAGGCACTCAAGGAGGGG - Intergenic
1059275939 9:113097164-113097186 TCGGTAAGGTACTCAAAGAATGG + Intergenic
1060757471 9:126223781-126223803 GAGCTAAGGAAGGCACAGAAGGG - Intergenic
1186467863 X:9797878-9797900 TAACCAAGGCAGTTAAAGAAAGG - Intronic
1186907372 X:14126287-14126309 TAGCTAAGGCTGTCTGAGCAAGG + Intergenic
1188152848 X:26700472-26700494 TTGATAAGGCAGTAAAAGGAAGG + Intergenic
1189867626 X:45347740-45347762 TAGATAAGTCACTCAAAAAAGGG - Intergenic
1190829563 X:54047802-54047824 TAGATAAGGTAGTCAAGGAAGGG + Intronic
1191940338 X:66473095-66473117 TAGCTAAGGGAGTCACAGAAAGG - Intergenic
1193326677 X:80186088-80186110 TAAATAAGTCAGTCACAGAAAGG - Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1194078284 X:89425351-89425373 TAGCAAAGAAAGTGAAAGAATGG - Intergenic
1195415686 X:104617815-104617837 CAGATAAAGAAGTCAAAGAATGG - Intronic
1195789944 X:108573085-108573107 TAGCTTGGGTAGTCAAAGAAGGG - Intronic
1196143207 X:112288520-112288542 TAGCAAAGGTTGTAAAAGAATGG + Intergenic
1196594546 X:117528487-117528509 TAGCTCAGGTAGTCAAAAAATGG - Intergenic
1197635764 X:128913279-128913301 AAGGAAAGGCAGTCACAGAAAGG + Intergenic
1198442731 X:136679752-136679774 TAGCAAAGACAGCCATAGAAAGG + Intronic
1198922091 X:141740511-141740533 TAACTAAGGCAGACAGAGAAGGG + Intergenic
1200430927 Y:3080884-3080906 TAGCAAAGAAAGTGAAAGAATGG - Intergenic
1200692535 Y:6321218-6321240 TAGCTAAGACAGTCACACCATGG - Intergenic
1201042738 Y:9853508-9853530 TAGCTAAGACAGTCACACCATGG + Intergenic
1201050168 Y:9924754-9924776 TAGCTAAGACAGTCACACCATGG - Intergenic
1201743227 Y:17345269-17345291 TAGATAACACAGTCAAAGAGTGG - Intergenic
1202113047 Y:21444622-21444644 TAGCTAAGACAGTCCCACAATGG + Intergenic