ID: 1034608641

View in Genome Browser
Species Human (GRCh38)
Location 7:152343613-152343635
Sequence GTGACCAGGTGTAGTTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034608641_1034608645 27 Left 1034608641 7:152343613-152343635 CCAAACAAACTACACCTGGTCAC 0: 1
1: 0
2: 0
3: 15
4: 127
Right 1034608645 7:152343663-152343685 AAAAACCTAAAAGAGGTCAGAGG No data
1034608641_1034608646 28 Left 1034608641 7:152343613-152343635 CCAAACAAACTACACCTGGTCAC 0: 1
1: 0
2: 0
3: 15
4: 127
Right 1034608646 7:152343664-152343686 AAAACCTAAAAGAGGTCAGAGGG No data
1034608641_1034608644 20 Left 1034608641 7:152343613-152343635 CCAAACAAACTACACCTGGTCAC 0: 1
1: 0
2: 0
3: 15
4: 127
Right 1034608644 7:152343656-152343678 ATACTGAAAAAACCTAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034608641 Original CRISPR GTGACCAGGTGTAGTTTGTT TGG (reversed) Intronic
900145189 1:1156159-1156181 CTGAGCAGGTGTAGTTTGAGTGG - Intergenic
903664258 1:24996844-24996866 GAGAGCGGGGGTAGTTTGTTTGG + Intergenic
906131564 1:43461835-43461857 GAGACCAGGTGTAGTTTAGCTGG - Intergenic
906372082 1:45262586-45262608 GTGAGCAGTTGTGGTGTGTTGGG - Intronic
908802910 1:67898432-67898454 GTTACCAGGTGGAGGTTGCTAGG - Intergenic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
909841460 1:80332082-80332104 GTGAACAAGTATATTTTGTTTGG + Intergenic
909976314 1:82049716-82049738 GGGAACAGGTGCAGTTTGCTTGG + Intergenic
910726327 1:90343635-90343657 GTTACCAGGTGGAGATTGTTAGG - Intergenic
911310008 1:96280485-96280507 GTGGCCAGGTGTCATTTTTTTGG + Intergenic
911828749 1:102523414-102523436 GTTGCCAGGTGTAGGTTGTTAGG + Intergenic
916759456 1:167803466-167803488 GTGACCAGGAATGGTTCGTTTGG + Intergenic
916819194 1:168381658-168381680 GTGAGCAGGTGGAGCTTGTTTGG + Intergenic
917746260 1:178010824-178010846 TTTCCCAGGTGTAGATTGTTGGG - Intergenic
917809269 1:178641879-178641901 GTTGCCAGGTGGAGATTGTTAGG + Intergenic
917974114 1:180228789-180228811 GTGAGCAGGTGTCCCTTGTTTGG + Intergenic
918736635 1:188072069-188072091 GTGCCAAGCTGTAGTTTCTTAGG + Intergenic
919604848 1:199669250-199669272 GTTGCCAGGTGGAGGTTGTTAGG - Intergenic
1064426297 10:15232651-15232673 GTTTCCAGATGTATTTTGTTTGG - Intronic
1067561197 10:47305776-47305798 GTGACCAGGTCCACTTTGCTGGG - Intronic
1071275421 10:84049772-84049794 GAGACCATGTGAAGTTTGTTAGG + Intergenic
1071278346 10:84076901-84076923 GTTGCCAGGTGGAGGTTGTTAGG - Intergenic
1074245431 10:111686374-111686396 GTGATGATGTGTAGTTTTTTCGG - Intergenic
1075397737 10:122140116-122140138 GGGACCAGTTGTTGTTTGTGAGG + Intronic
1076360414 10:129884636-129884658 GTGCCCAGATGTCCTTTGTTGGG + Intronic
1079894199 11:26098255-26098277 GTTGCCAGGTGTGGGTTGTTAGG - Intergenic
1081903698 11:46652256-46652278 GTGAGCAGCACTAGTTTGTTTGG - Intronic
1082192100 11:49258459-49258481 GTTACCAGGTCTAGTATATTGGG + Intergenic
1086332708 11:85769935-85769957 GTTGCCAGGTGGAGGTTGTTAGG - Intronic
1086410527 11:86540197-86540219 GTTGCCAGGTGGAGGTTGTTAGG + Intronic
1086674028 11:89582573-89582595 GTTACCAGGTCTAGTATATTGGG - Intergenic
1087724860 11:101705427-101705449 GTTACCAGGTGGAGGTTGTTAGG + Intronic
1091555232 12:1568085-1568107 ATGCCCAGGTGTAGTTTTTCTGG - Intronic
1099237111 12:80095069-80095091 GTTGCCAGGTGAAGGTTGTTAGG - Intergenic
1099280939 12:80645235-80645257 ATTAACAGGTGTACTTTGTTAGG - Intronic
1108333247 13:49411887-49411909 GTTACCAGGTGGAGGTTGTTAGG + Intronic
1108440672 13:50449800-50449822 TGGACCAGGTGTAGTTTGCTAGG - Intronic
1108535320 13:51370754-51370776 GTTGCCAGGTGGAGGTTGTTAGG - Intronic
1113736682 13:112684117-112684139 GTGCCCAGGAGGAGTTTGTGGGG - Exonic
1114772683 14:25446223-25446245 GTGACCAAGTGTAGTCTCTGGGG + Intergenic
1115181093 14:30626523-30626545 GTTGCCAGGTGGAGGTTGTTAGG + Intronic
1116806779 14:49501493-49501515 GTTGCCAGGTGGAGGTTGTTAGG - Intergenic
1117375037 14:55112033-55112055 GTTGCCAGGTGGAGGTTGTTAGG + Intergenic
1119740524 14:77011172-77011194 GTTGCCAGGTGGAGGTTGTTAGG - Intergenic
1119977048 14:79036851-79036873 GGGACCAGGTGGAGTTCCTTGGG + Intronic
1122395988 14:101431742-101431764 ATGACCACGTGTGGTTTGTCAGG - Intergenic
1124079036 15:26474367-26474389 GTGACAATGTGAAGTTTGGTAGG + Intergenic
1124992470 15:34689534-34689556 GTCAGCAGGTTTAGTTTCTTTGG - Intergenic
1126311099 15:47317821-47317843 CTGCCCAGGTGTAGTGTTTTAGG + Intronic
1127312845 15:57767794-57767816 GTTGCCAGGTGGAGGTTGTTAGG - Intronic
1127915389 15:63450918-63450940 GTTGCCAGGTGGAGGTTGTTAGG - Intergenic
1128237790 15:66079504-66079526 GTTCCCAGGTGGAGGTTGTTAGG - Intronic
1128428868 15:67572118-67572140 GTGTCCAGGTGGAGTAAGTTAGG + Intronic
1128574892 15:68766953-68766975 GTTGCCAGGTGAAGGTTGTTAGG + Intergenic
1130231874 15:82103343-82103365 ATGACCAAGTGGAGATTGTTAGG + Intergenic
1130931088 15:88428461-88428483 GTGACCATCTGTAGCTTGTGGGG - Intergenic
1131713108 15:95077425-95077447 CTGAGCAAGTGAAGTTTGTTTGG - Intergenic
1139232573 16:65298545-65298567 GTACCCAAGTGTAGTTTTTTTGG - Intergenic
1141237116 16:82228992-82229014 GTGGCCAGGTGTGGCTTGTCTGG + Intergenic
1143891883 17:10108221-10108243 GTTGCCAGGTGGAGGTTGTTAGG - Intronic
1147382139 17:40062492-40062514 GCTTGCAGGTGTAGTTTGTTTGG - Intronic
1149019040 17:51942292-51942314 GTGACCAGTTGTGTTGTGTTTGG - Intronic
1149363739 17:55920098-55920120 GTTGCCAGGTGGAGGTTGTTAGG - Intergenic
1151426656 17:74035112-74035134 GTGCCCAGGTGGAGATGGTTAGG + Intergenic
1152655337 17:81516801-81516823 GTGGCCAGGTGCTGCTTGTTTGG + Intronic
1155826254 18:30446870-30446892 GTGGCCAGGTGGAAGTTGTTAGG + Intergenic
1156355539 18:36337321-36337343 GTGACCAGGTCTGGTGTGTTTGG - Intronic
1159856739 18:73598149-73598171 GTGAGAAGGTGTAGTTGGTGAGG + Intergenic
1166211245 19:41307984-41308006 GAGACCAGGGCTGGTTTGTTTGG + Intronic
1166339691 19:42130166-42130188 GTGACTGGGTGTAGTATGTAGGG - Intronic
1168503691 19:56915349-56915371 GTGACCTAATGTAATTTGTTGGG + Intergenic
930116759 2:47724812-47724834 GTGAAAAGGAGTAGTTTGTTTGG + Intronic
932978279 2:76630654-76630676 GTGCCTAGGTGTAGATTTTTTGG + Intergenic
933559295 2:83872191-83872213 GTTGCCAGGTGAAGGTTGTTAGG + Intergenic
934548141 2:95235753-95235775 GTGGTCAAGTTTAGTTTGTTAGG + Intronic
937459627 2:122074711-122074733 GTTACCAGGTGGAGGTTTTTAGG - Intergenic
940865132 2:158810291-158810313 CTGACCAGCTGTATATTGTTAGG - Intronic
941806880 2:169718587-169718609 GTTGCCAGGTGGAGGTTGTTAGG - Intronic
941869195 2:170366002-170366024 GTTGCCAGGTGGAGGTTGTTAGG + Intronic
942436092 2:175978442-175978464 GTGACCAGGTAGATTTTGTAAGG + Intronic
943214072 2:185007569-185007591 ATGTCCAGGTGTAGATTTTTAGG - Intergenic
1177824222 21:26064678-26064700 GTTGCCAGGTGGAGATTGTTAGG - Intronic
1178711717 21:34923041-34923063 ATGACCATCTGTAGTTTTTTGGG - Intronic
1184894620 22:47399931-47399953 GGGACCAGGTGGAGGTGGTTGGG - Intergenic
1184933445 22:47699056-47699078 GTGAGCATGTGCAGTGTGTTGGG + Intergenic
953193058 3:40707537-40707559 GTACCTAGGTGTAGTTTTTTTGG + Intergenic
955442749 3:58974712-58974734 GTTTCCAGGTGGAGGTTGTTAGG + Intronic
955491735 3:59489733-59489755 TTGGTCAGGTGTAGCTTGTTAGG + Intergenic
956204121 3:66738384-66738406 GTTGCCAGGTGGAGGTTGTTAGG + Intergenic
956696090 3:71920618-71920640 GTTGCCAGGTGGAGGTTGTTAGG - Intergenic
961905386 3:130257540-130257562 ATGTCCAGTTGTGGTTTGTTGGG - Intergenic
962216572 3:133527561-133527583 GTGACCAGGACTAGTGTGTGAGG - Intergenic
963909428 3:150802903-150802925 GTTGCCAGGTGGAGATTGTTGGG - Intergenic
963966809 3:151381027-151381049 GTGACCAGGAGAACTGTGTTTGG - Intronic
965805426 3:172536754-172536776 GTTAACAGGTGTAACTTGTTTGG + Intergenic
970312156 4:14793752-14793774 GTGAGCTGGTGTAATTTTTTGGG - Intergenic
971410795 4:26369674-26369696 CTGACCAGATTTGGTTTGTTAGG + Intronic
976327187 4:83785075-83785097 GTTACAAGGTGTGGGTTGTTAGG - Intergenic
977932725 4:102766087-102766109 ATGCCCAGGTGTAGTTTTTTGGG - Intergenic
977952294 4:102986436-102986458 ATGGCTAGGTGTAGTCTGTTTGG + Intronic
981785483 4:148473877-148473899 GTGACTATGTGAAGCTTGTTAGG - Intergenic
985517366 5:353984-354006 GTGGCCAGGTGAAGTGTGTCTGG + Intronic
986096500 5:4559673-4559695 ATGAACAGGCTTAGTTTGTTGGG + Intergenic
986151224 5:5132453-5132475 GTGTGCAGGAGTAGTTTGGTTGG - Intergenic
990141258 5:52706899-52706921 GTTGCCAGGTGGAGGTTGTTGGG - Intergenic
991596747 5:68314386-68314408 GTTATCAGGTGGAGTTTGCTGGG + Intergenic
992169859 5:74090754-74090776 GAGCCCAGGTGCAGTCTGTTTGG - Intergenic
994075256 5:95643147-95643169 GTTGCCAGGTGGAGATTGTTAGG + Intergenic
994958047 5:106560806-106560828 GTTTCCAGTTGTACTTTGTTAGG - Intergenic
997652032 5:135529393-135529415 GTTACTATGTGTGGTTTGTTTGG + Intergenic
1004615739 6:17287170-17287192 ATGACCAGGTGTGATTTGTTAGG - Intronic
1004756075 6:18611786-18611808 GTGACAAGGTGCTGTTTATTTGG + Intergenic
1005596504 6:27383403-27383425 GCCACTAGGTGTAGTTTTTTGGG - Intronic
1006379006 6:33687133-33687155 GGAACCAGGTGGAGTGTGTTGGG + Intronic
1010406571 6:75512758-75512780 GTGGCCAGATGGAGTTTGTCTGG + Intergenic
1010741234 6:79507772-79507794 GTTGCCAGGTGGAGGTTGTTAGG + Intronic
1011605138 6:89096087-89096109 GTGACTAGGTGAAAATTGTTTGG - Exonic
1013645504 6:112135350-112135372 GTTACCAGGTGTAATTTTTTTGG + Intronic
1022217809 7:28281535-28281557 GTTACCAGTTGGAGGTTGTTAGG + Intergenic
1023274396 7:38502553-38502575 GTTGCCAGGTGGAGGTTGTTAGG + Intronic
1023895254 7:44427633-44427655 GTGACCAGGTGTAGTTCTCTCGG + Exonic
1028049479 7:86164060-86164082 GTTACCAGGTGGAGGTCGTTAGG - Intergenic
1028973976 7:96891600-96891622 GTTGCCAGGTGGAGGTTGTTAGG + Intergenic
1034108808 7:148516099-148516121 GTGACCAGGTGTAGATTTCAGGG - Intergenic
1034608641 7:152343613-152343635 GTGACCAGGTGTAGTTTGTTTGG - Intronic
1043159413 8:76827152-76827174 GTGGTCAGGTGTAGATGGTTTGG + Intronic
1046854721 8:119018072-119018094 CTGACCTGCTGTACTTTGTTTGG + Intronic
1048775344 8:137939637-137939659 GTACCCAGGTGTTGTTTCTTGGG + Intergenic
1052508126 9:29381112-29381134 GTGACCAGGTGTAGGCTGCATGG + Intergenic
1052669502 9:31537856-31537878 GTGAACAAGTGTTCTTTGTTGGG - Intergenic
1055335465 9:75229207-75229229 GTTGCCAGGTGGAGGTTGTTAGG + Intergenic
1057287144 9:93765971-93765993 ATGCCTAGGTGTAGTTTCTTTGG - Intergenic
1057418398 9:94886267-94886289 GGGACCAGGTGTGCTGTGTTGGG + Intronic
1058365895 9:104207865-104207887 ATGCCCAGGTGTGGTTTTTTGGG - Intergenic
1060800132 9:126538884-126538906 GGGACCATGTTTATTTTGTTTGG - Intergenic
1062471457 9:136707428-136707450 CTCACCAGGTGGAGTTTCTTGGG + Intergenic
1189349580 X:40266745-40266767 GTGCCCAGTTGGAGTTTGTGTGG + Intergenic
1196990861 X:121327080-121327102 GTTGCCAGGTGAAGGTTGTTAGG + Intergenic
1197040639 X:121931829-121931851 GAGACCAGGTGGAGGTTATTGGG - Intergenic
1199201936 X:145101437-145101459 GTTACCAGGTAAAGTTTTTTTGG - Intergenic
1200683887 Y:6243892-6243914 TTGACCAGATGTAGATTGTTTGG - Intergenic
1201048748 Y:9910494-9910516 TTGACCAGATGTAGATTGTTTGG + Intergenic
1202115291 Y:21465803-21465825 TTGACCAGAGGTAGATTGTTTGG - Intergenic