ID: 1034612569

View in Genome Browser
Species Human (GRCh38)
Location 7:152385182-152385204
Sequence CCTGTAGAGTTCCTGTAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 1, 2: 2, 3: 8, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034612569_1034612575 27 Left 1034612569 7:152385182-152385204 CCTGACTACAGGAACTCTACAGG 0: 1
1: 1
2: 2
3: 8
4: 92
Right 1034612575 7:152385232-152385254 AATTGTGAGAATAAAAAGGAAGG 0: 1
1: 1
2: 2
3: 68
4: 658
1034612569_1034612576 30 Left 1034612569 7:152385182-152385204 CCTGACTACAGGAACTCTACAGG 0: 1
1: 1
2: 2
3: 8
4: 92
Right 1034612576 7:152385235-152385257 TGTGAGAATAAAAAGGAAGGTGG No data
1034612569_1034612574 23 Left 1034612569 7:152385182-152385204 CCTGACTACAGGAACTCTACAGG 0: 1
1: 1
2: 2
3: 8
4: 92
Right 1034612574 7:152385228-152385250 AATAAATTGTGAGAATAAAAAGG 0: 1
1: 2
2: 8
3: 109
4: 1206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034612569 Original CRISPR CCTGTAGAGTTCCTGTAGTC AGG (reversed) Intronic
902956405 1:19926892-19926914 CCTGTAGAGTACCTGAAGTCCGG + Intergenic
906300007 1:44674728-44674750 GCTGAAGAGTTGCTGTATTCTGG + Exonic
907367748 1:53976667-53976689 CCTCTTGAGTTTCTGTAGTGAGG + Intergenic
908765766 1:67553531-67553553 CTTCTAGAGTTCCTGGAGTTGGG - Intergenic
911849597 1:102800843-102800865 CTTGTATAGTTCCTGTAATCAGG + Intergenic
913269532 1:117079487-117079509 AGTGTAGAGTTCGTGTAGCCAGG + Intronic
915140368 1:153764155-153764177 CTTGAAGAGCTCCTGTAGGCAGG - Exonic
917494224 1:175525545-175525567 CCTCAAGAGTTCCTGAAATCTGG + Intronic
919360274 1:196584077-196584099 CCTTTATAGTTCCTTTAGTTTGG - Intronic
920372992 1:205491554-205491576 CCTGAAGATTCACTGTAGTCTGG + Intergenic
920577621 1:207073057-207073079 TCTGTGGATGTCCTGTAGTCTGG - Exonic
924623683 1:245683740-245683762 CCTGCACAGTTCCTTTAGCCAGG - Intronic
1071208129 10:83307448-83307470 ACTGTACAGTTCCTGTAGTGTGG - Intergenic
1071316011 10:84398903-84398925 TCTGTACAGTGCCTGTATTCTGG + Intronic
1075544256 10:123342623-123342645 CCTGGAGAGTCCCCGAAGTCAGG + Intergenic
1079777990 11:24558299-24558321 CCTGTAGACTGCCTGCAGGCTGG - Intronic
1081228814 11:40559399-40559421 GCTGTTGAATTCCTGTACTCAGG + Intronic
1084607591 11:70181424-70181446 CCTGCAGCCTTCCTGTAATCTGG - Intronic
1086386347 11:86312901-86312923 CCTGTAGAGTTTCTGTGGAGAGG + Intronic
1089171358 11:116513837-116513859 ACTGTAAAGTTCCTGTGGTCAGG + Intergenic
1090469614 11:126968770-126968792 CCTGTAGAGTTCCTGATTTGTGG - Intronic
1090686099 11:129121687-129121709 CCTGTAGAATTCCATTACTCAGG - Intronic
1091285295 11:134405388-134405410 CCTGGTGAGGTCCTGTGGTCAGG + Intronic
1092444016 12:8536892-8536914 CATGTGGAGTTCCTTTAGTTAGG - Intronic
1092826280 12:12402523-12402545 CCTGCAGAGTTCCTGAATTGAGG + Intronic
1101163863 12:102007854-102007876 CTTTTAGAGATCCAGTAGTCTGG + Intronic
1101934971 12:109049911-109049933 CCAATAGACTTGCTGTAGTCAGG + Intronic
1104104083 12:125642621-125642643 GCTGAAGAGTTACTGGAGTCTGG - Intronic
1105205177 13:18217291-18217313 CCTGTAGAGTTCCTACACACTGG + Intergenic
1112710225 13:102119278-102119300 CTTGTAGAGTACCTGTGTTCAGG - Intronic
1113446524 13:110372435-110372457 CCTGTAGAGTTTCTCTTCTCTGG + Intronic
1114194689 14:20466841-20466863 CCTGTAGCATTCCTATAGACAGG - Intergenic
1114946555 14:27688945-27688967 CCTGTAGAGTGCCTGTGCACTGG + Intergenic
1115712866 14:36069858-36069880 CCTGTAGGGTTCTTCTATTCTGG + Intergenic
1130356119 15:83131970-83131992 CCAGTAGAGTTCATATAGTTAGG + Exonic
1131260831 15:90886866-90886888 CCTGGAAAGGTCCTGTCGTCAGG - Intronic
1131350513 15:91695364-91695386 CCAGCAGAGTTCCTATAGTGTGG + Intergenic
1137803309 16:51280916-51280938 CCTGTAGAGATGGTGTAGTTAGG - Intergenic
1138356874 16:56388980-56389002 CCTAAAAAATTCCTGTAGTCTGG - Intronic
1140727622 16:77828264-77828286 CCTGTAAAGTTCCTTTTGCCAGG - Intronic
1142296785 16:89229113-89229135 CCTGTAGAAATCCTCCAGTCTGG + Exonic
1146683636 17:34825953-34825975 CCTGGACAGATCCTGTGGTCAGG - Intergenic
1156400503 18:36735265-36735287 CCTGTACAGTTCCTGTCCACAGG + Intronic
1160619798 18:80162858-80162880 CCTGTAGAGTCCATCTGGTCTGG + Intronic
1161775504 19:6260054-6260076 CCTCTAGAGCTCCTGTTGCCTGG - Intronic
1164291833 19:23876602-23876624 CCTGTGGGGTACCTGAAGTCCGG + Intergenic
1165556436 19:36636567-36636589 CCTGTAGGGTACCTGAAGTCCGG + Intergenic
1166424734 19:42667580-42667602 CCCGTAGGGTACCTGAAGTCTGG + Intronic
1168640062 19:58025138-58025160 CCTGTAGAGTCCCAGGAGCCTGG + Intergenic
1168723726 19:58569571-58569593 TCTCTAGATTTCCTGGAGTCTGG - Exonic
926176611 2:10598271-10598293 CCTGTTCAGTTCCTGCAGACAGG + Intronic
928206277 2:29286223-29286245 CCTGTGGAGGTCCTGTGATCTGG + Intronic
934998831 2:98990870-98990892 CTTGTAGAGTTTCTGTCTTCTGG - Intergenic
935366822 2:102302206-102302228 CCTGGAGAGTTTCTGAACTCTGG - Intergenic
942153312 2:173100671-173100693 TCTGTAGGGTTCCTGATGTCTGG + Intronic
943540463 2:189207548-189207570 CATGTACACTTCCTGTAGGCAGG - Intergenic
944437520 2:199706160-199706182 ACTCTAGACTTCCTGTATTCAGG - Intergenic
1176725181 21:10425902-10425924 CCTGTAGAGTTCCCGTAGTCAGG + Intergenic
1178098161 21:29237447-29237469 CTTGTTGAGTTCCTGTAGCCTGG + Intronic
1178532228 21:33385396-33385418 CCTGTGGAGTGCCTGGAGTAGGG + Intergenic
1180829057 22:18888693-18888715 CCTGTAGAGTTCCTACACACTGG - Intergenic
1181675474 22:24448643-24448665 CCTGGTGAGTCCCTGTAGCCTGG - Intergenic
1182151276 22:28028841-28028863 CCTGCAGGGTTCCTGTAATGTGG - Intronic
1182500189 22:30741088-30741110 CCTGGAGGGTTTCTTTAGTCTGG + Intronic
1183678745 22:39314489-39314511 CCTGTAGAGTGGCTGTGGTGGGG - Intronic
1203279148 22_KI270734v1_random:114680-114702 CCTGTAGAGTTCCTACACACTGG - Intergenic
952392564 3:32892903-32892925 TCTGTGGAGTTCCTATAGTTTGG - Exonic
953588520 3:44228472-44228494 CCTGTAAATTTTCTGTAGTAAGG + Intergenic
959789514 3:110342119-110342141 ACTTTAGAGTTCATCTAGTCTGG + Intergenic
962221665 3:133569503-133569525 CCTGGATAGTTGCTGTTGTCTGG + Intergenic
964844218 3:161028324-161028346 AATGTAGAGTCCCTGTAGTTTGG + Intronic
967622925 3:191655650-191655672 CCTTTTGAGTTACTGTAGTCAGG - Intergenic
972151735 4:36099415-36099437 TCTGTGGATTTCTTGTAGTCAGG - Intronic
974892407 4:67897738-67897760 TCTGCAGAGTTCCTTTTGTCAGG + Intergenic
975427129 4:74243306-74243328 CCTGCAGAGTTCCTGTACTCAGG - Intronic
975487278 4:74948345-74948367 GCTTTGGAGTTCCTGAAGTCAGG - Intronic
980287167 4:130795431-130795453 TCTGAAGAGTTACTGTAGTGTGG + Intergenic
989568990 5:42927527-42927549 CCGGTAGAGTCCCTGTATCCAGG - Intergenic
995929748 5:117425405-117425427 CCTGCAGGGTTGCTGTAGTTTGG + Intergenic
1004427286 6:15514877-15514899 CCTGTAGATTTCCTTCTGTCTGG + Intronic
1004955009 6:20720021-20720043 CCTGTAGCCTTTCCGTAGTCTGG + Intronic
1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1006157416 6:32023267-32023289 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1010939585 6:81900560-81900582 CTTCAAGAGTTCCTGCAGTCAGG + Intergenic
1013763491 6:113546521-113546543 CCTGTAGACTGCATATAGTCAGG - Intergenic
1014411246 6:121124376-121124398 CCTGTAAAGTATCTGTTGTCAGG + Intronic
1022305253 7:29141020-29141042 CCTGTAGAGTTCAAGAAGTTGGG + Intronic
1029692639 7:102192366-102192388 CCTGTAAATTTCCTGGAGTACGG + Intronic
1031625917 7:123992598-123992620 CCTCTAGAGTTCCTGACGACAGG - Intergenic
1031965480 7:128025128-128025150 CATGTGGAGCCCCTGTAGTCAGG + Intronic
1034612569 7:152385182-152385204 CCTGTAGAGTTCCTGTAGTCAGG - Intronic
1035179259 7:157077406-157077428 CCAGTGAAGTTCCTGTAGTGAGG - Intergenic
1035264457 7:157683520-157683542 CCTGGAGAGTGACTGGAGTCAGG - Intronic
1037503881 8:19511576-19511598 CCAGTTGAATTCCTGTAGGCAGG + Intronic
1042216126 8:66430849-66430871 CCTGTAGAGTCCCAGTACTTTGG + Intronic
1044901378 8:96949049-96949071 CCTGTGGAGTGCATGTAGTTGGG + Intronic
1045669772 8:104537168-104537190 CCTGGAGACTTCCTGGACTCTGG + Intronic
1047360894 8:124168346-124168368 CCTGGAGAGTTCCTGACTTCAGG - Intergenic
1049477805 8:142804914-142804936 CCTGTAGGCTTCCTGTAGGGTGG + Intergenic
1052993976 9:34539846-34539868 CCCGTAGGGTACCTGAAGTCTGG + Intergenic
1057807897 9:98233673-98233695 CATGTAGGGTGCCTGGAGTCTGG - Intronic
1186063510 X:5737285-5737307 TCTATACAGTCCCTGTAGTCTGG + Intergenic
1195946581 X:110220396-110220418 CCTGCAGATTTCCAGTAGACAGG - Intronic
1199475981 X:148245722-148245744 CTTGTAGGGTTCCTGGAGTATGG + Intergenic