ID: 1034618174

View in Genome Browser
Species Human (GRCh38)
Location 7:152436260-152436282
Sequence GGCCTGACGGGCCTGACGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034618174_1034618188 29 Left 1034618174 7:152436260-152436282 CCGCGCGTCAGGCCCGTCAGGCC No data
Right 1034618188 7:152436312-152436334 GCTGCTCCAGTGGCGGCGCTGGG No data
1034618174_1034618187 28 Left 1034618174 7:152436260-152436282 CCGCGCGTCAGGCCCGTCAGGCC No data
Right 1034618187 7:152436311-152436333 AGCTGCTCCAGTGGCGGCGCTGG No data
1034618174_1034618186 22 Left 1034618174 7:152436260-152436282 CCGCGCGTCAGGCCCGTCAGGCC No data
Right 1034618186 7:152436305-152436327 TTTGACAGCTGCTCCAGTGGCGG No data
1034618174_1034618181 -10 Left 1034618174 7:152436260-152436282 CCGCGCGTCAGGCCCGTCAGGCC No data
Right 1034618181 7:152436273-152436295 CCGTCAGGCCCGGGCGGCGGCGG No data
1034618174_1034618185 19 Left 1034618174 7:152436260-152436282 CCGCGCGTCAGGCCCGTCAGGCC No data
Right 1034618185 7:152436302-152436324 AGTTTTGACAGCTGCTCCAGTGG No data
1034618174_1034618182 -7 Left 1034618174 7:152436260-152436282 CCGCGCGTCAGGCCCGTCAGGCC No data
Right 1034618182 7:152436276-152436298 TCAGGCCCGGGCGGCGGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034618174 Original CRISPR GGCCTGACGGGCCTGACGCG CGG (reversed) Intergenic