ID: 1034621400

View in Genome Browser
Species Human (GRCh38)
Location 7:152460036-152460058
Sequence GGTTAAGTGTCATCCCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034621400_1034621406 10 Left 1034621400 7:152460036-152460058 CCCTGAGGGGATGACACTTAACC No data
Right 1034621406 7:152460069-152460091 CTGCAGCTGAGCCGCAGGGATGG No data
1034621400_1034621404 5 Left 1034621400 7:152460036-152460058 CCCTGAGGGGATGACACTTAACC No data
Right 1034621404 7:152460064-152460086 AGAGGCTGCAGCTGAGCCGCAGG No data
1034621400_1034621405 6 Left 1034621400 7:152460036-152460058 CCCTGAGGGGATGACACTTAACC No data
Right 1034621405 7:152460065-152460087 GAGGCTGCAGCTGAGCCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034621400 Original CRISPR GGTTAAGTGTCATCCCCTCA GGG (reversed) Intergenic
No off target data available for this crispr