ID: 1034622063

View in Genome Browser
Species Human (GRCh38)
Location 7:152464018-152464040
Sequence GTCTCCCTCCTCTCGGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 158}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034622063_1034622077 -2 Left 1034622063 7:152464018-152464040 CCTCCCCCCGAGAGGAGGGAGAC 0: 1
1: 0
2: 1
3: 21
4: 158
Right 1034622077 7:152464039-152464061 ACCCGGAAGGCGGTGGGGGCGGG 0: 1
1: 0
2: 1
3: 29
4: 679
1034622063_1034622076 -3 Left 1034622063 7:152464018-152464040 CCTCCCCCCGAGAGGAGGGAGAC 0: 1
1: 0
2: 1
3: 21
4: 158
Right 1034622076 7:152464038-152464060 GACCCGGAAGGCGGTGGGGGCGG 0: 1
1: 0
2: 4
3: 72
4: 1733
1034622063_1034622074 -7 Left 1034622063 7:152464018-152464040 CCTCCCCCCGAGAGGAGGGAGAC 0: 1
1: 0
2: 1
3: 21
4: 158
Right 1034622074 7:152464034-152464056 GGGAGACCCGGAAGGCGGTGGGG 0: 1
1: 0
2: 1
3: 22
4: 245
1034622063_1034622075 -6 Left 1034622063 7:152464018-152464040 CCTCCCCCCGAGAGGAGGGAGAC 0: 1
1: 0
2: 1
3: 21
4: 158
Right 1034622075 7:152464035-152464057 GGAGACCCGGAAGGCGGTGGGGG 0: 1
1: 0
2: 2
3: 35
4: 358
1034622063_1034622073 -8 Left 1034622063 7:152464018-152464040 CCTCCCCCCGAGAGGAGGGAGAC 0: 1
1: 0
2: 1
3: 21
4: 158
Right 1034622073 7:152464033-152464055 AGGGAGACCCGGAAGGCGGTGGG 0: 1
1: 0
2: 2
3: 11
4: 172
1034622063_1034622079 -1 Left 1034622063 7:152464018-152464040 CCTCCCCCCGAGAGGAGGGAGAC 0: 1
1: 0
2: 1
3: 21
4: 158
Right 1034622079 7:152464040-152464062 CCCGGAAGGCGGTGGGGGCGGGG 0: 1
1: 0
2: 6
3: 47
4: 612
1034622063_1034622072 -9 Left 1034622063 7:152464018-152464040 CCTCCCCCCGAGAGGAGGGAGAC 0: 1
1: 0
2: 1
3: 21
4: 158
Right 1034622072 7:152464032-152464054 GAGGGAGACCCGGAAGGCGGTGG 0: 1
1: 0
2: 1
3: 25
4: 354
1034622063_1034622081 4 Left 1034622063 7:152464018-152464040 CCTCCCCCCGAGAGGAGGGAGAC 0: 1
1: 0
2: 1
3: 21
4: 158
Right 1034622081 7:152464045-152464067 AAGGCGGTGGGGGCGGGGAGTGG 0: 1
1: 1
2: 21
3: 253
4: 1967

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034622063 Original CRISPR GTCTCCCTCCTCTCGGGGGG AGG (reversed) Intergenic
900603740 1:3514812-3514834 GTCTCCCTCCTCCCAGGTGCGGG + Intronic
900650549 1:3728053-3728075 GTCTCCCTCCTCCCGGAAGGAGG + Intronic
902330111 1:15727181-15727203 CTCTCCCTCCTCCTGGGGGGAGG - Exonic
902337998 1:15764890-15764912 GGCTCTCTCCTCTCGGGGGAGGG + Intronic
911969210 1:104408511-104408533 GGCTCCCTCTGCTCGAGGGGTGG - Intergenic
913124360 1:115771698-115771720 GTCTCCTGCCTTTCTGGGGGCGG - Intergenic
914442427 1:147719097-147719119 GTCTCCCTCAGCTTAGGGGGTGG + Intergenic
916079654 1:161224451-161224473 GTCTCACTCCTGTTGGGGGTGGG + Intergenic
920424941 1:205867474-205867496 CTTTCCCTCCTCTCGGGGACAGG + Intergenic
922576364 1:226663428-226663450 GTGTCCCTGCTCCCGGTGGGCGG - Intronic
922616347 1:226963308-226963330 GTCTCCCTTCTCGCGAGGGGAGG + Intronic
922917245 1:229268999-229269021 GTCTCCCTTCTCTTTGGGGGAGG - Intergenic
923975307 1:239255895-239255917 GGCTCCCTCTGCTTGGGGGGAGG - Intergenic
924738662 1:246781526-246781548 GTCTTCCTCCTCACTGGGTGAGG + Intergenic
924772291 1:247088538-247088560 GTCTGCCTCCCCTGGGGAGGAGG + Intergenic
1063759431 10:9056719-9056741 GGCTCCCTCTGCTCGCGGGGAGG + Intergenic
1066235513 10:33480855-33480877 GTCTCCCTCAGCTTGCGGGGAGG - Intergenic
1068555003 10:58448646-58448668 GACTCCCTCTTCTTGCGGGGAGG - Intergenic
1069539255 10:69281322-69281344 GTCCCCGTCCTCTAGGGTGGTGG - Intronic
1069565299 10:69459924-69459946 GTCTCCCTCCATTCGTGGGGGGG - Intronic
1069902557 10:71714477-71714499 GTCTCCTACCTCTCTTGGGGAGG - Exonic
1071086800 10:81875153-81875175 GCCGCCCGCCTCTCGGGGGGAGG + Intergenic
1073326058 10:102644450-102644472 GGCTCCCTCCTCCGGGGGGCGGG + Intergenic
1076464429 10:130668820-130668842 GTCTCCTTCCTCCCGGGAGAGGG - Intergenic
1076628794 10:131840180-131840202 GTCTCCCTTTCCCCGGGGGGGGG - Intergenic
1076777380 10:132705242-132705264 GTCCGCCTCCTCTCTCGGGGAGG - Intronic
1077583834 11:3435334-3435356 GTCTCCCTCAGCTTGCGGGGAGG - Intergenic
1078205804 11:9228360-9228382 GTCTCTCTCCTCTCTGCAGGTGG - Intronic
1083886179 11:65574495-65574517 GTTTCCCTCCTCAAGGTGGGCGG - Intergenic
1084650883 11:70488572-70488594 GGCTCCCTCCCCTCAGGGGCAGG - Intronic
1084944782 11:72632724-72632746 CCCTCCCTCCTCTCAGGGGAGGG - Intronic
1089317266 11:117600583-117600605 TCCTCCCTCCTCTGGTGGGGAGG - Intronic
1089359593 11:117876901-117876923 TCCTCTCTCCTCTCGAGGGGCGG + Exonic
1094218435 12:27970019-27970041 GTCTACCTCCTCTGGTGGGCTGG + Exonic
1096463277 12:51834541-51834563 GTCTGGCTCCTCTCTGGGGTGGG + Intergenic
1097170411 12:57109843-57109865 CTCTCCCTCATCTCTGGGAGAGG - Intronic
1097244969 12:57602772-57602794 CTCTGACTCCTCTCTGGGGGTGG - Exonic
1100078873 12:90824032-90824054 GGCTCCCTCTGCTCGCGGGGAGG + Intergenic
1100125494 12:91419870-91419892 GTCACCCTCCTTTCAGGTGGAGG + Intergenic
1102768181 12:115451298-115451320 GTCTCCTTCCTCTCGGCTGCAGG - Intergenic
1103760915 12:123249662-123249684 GGCTCCCTCCGCTTGTGGGGAGG - Intronic
1104953638 12:132453553-132453575 GTCTGGGTCCTGTCGGGGGGTGG + Intergenic
1104977875 12:132560297-132560319 GTCCCGCTCTTCTGGGGGGGCGG - Intronic
1108958541 13:56190180-56190202 CTCTCCCTCCCATGGGGGGGTGG + Intergenic
1109364586 13:61339136-61339158 GGCTCCCTCCGCTTGCGGGGAGG + Intergenic
1112788201 13:102974762-102974784 CTCTCCCTCCTCCCTGGGGAGGG - Intergenic
1113432413 13:110262178-110262200 GACCCCCACCTCTCGGGGTGCGG - Intronic
1115399288 14:32939257-32939279 CTCTCCCCCCTCCCGGGTGGGGG - Intronic
1119293600 14:73515809-73515831 GCCTCCCTCCTTTCTGGGGTAGG + Intronic
1119293664 14:73516284-73516306 GCCTCCCTCCTTTCTGGGGTAGG + Intronic
1124818515 15:33019865-33019887 GGCTCCCTCCGCTTGCGGGGAGG - Intronic
1125518337 15:40335226-40335248 GGCTGCCTCCTCTCGTGGGCCGG + Exonic
1127010486 15:54620901-54620923 GTCTCCCTGGTGTTGGGGGGAGG + Intronic
1127073792 15:55307174-55307196 TTTTCCCTCCTCTCGGGGACAGG + Intronic
1128249883 15:66156555-66156577 TTCTCCCTCCTCTCGGGGGCCGG - Intronic
1128456672 15:67835142-67835164 GGCTCCCTCCTTTCGGGTAGCGG - Intergenic
1131251653 15:90834839-90834861 CCCTCCCTCCACTCGGGGGTAGG + Intergenic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1133339057 16:5025160-5025182 GTCTCCCTCCTCCTGGGGAAGGG - Exonic
1138100006 16:54244685-54244707 GTCACGCTCCTCTGGGTGGGTGG + Intergenic
1139088567 16:63617525-63617547 GGCTCCCTCTGCTCGCGGGGAGG - Intergenic
1139962269 16:70724847-70724869 GTCTCCCTCCCCTCAGCTGGGGG + Intronic
1140419617 16:74807624-74807646 GCCTCTCTCCTCTCCTGGGGAGG - Intergenic
1142361867 16:89631164-89631186 GCCTGCCTTCTCCCGGGGGGAGG + Intronic
1143663879 17:8345100-8345122 TTCTCCCTCTTCTTTGGGGGTGG + Intronic
1144727907 17:17511046-17511068 GGCTCCCACCTCTCTGGGGATGG + Intronic
1147140191 17:38456291-38456313 GTCTCCCTCCACTGGGTGTGTGG + Intronic
1150483995 17:65531649-65531671 GCCTCTCTCCTCTCTGGAGGAGG - Intronic
1151250777 17:72832909-72832931 GTCTCCCTCCTCTGTTGAGGTGG - Intronic
1152800841 17:82330022-82330044 GTCTCCCACCGCACTGGGGGTGG - Intronic
1156036182 18:32770379-32770401 GCCACCCCCCTCTCGGGGGAGGG - Exonic
1156119118 18:33820621-33820643 GGCTCCCTCTGCTCGCGGGGAGG - Intergenic
1156683526 18:39618426-39618448 GGCTCCCTCTGCTTGGGGGGAGG + Intergenic
1158150046 18:54357762-54357784 TTCTCCCTCCTTTCTGGGGCTGG - Intronic
1159851150 18:73528571-73528593 GTCTCCCTCCTGTCTGGCTGGGG - Intergenic
1160388865 18:78515179-78515201 TTCTCCCTCCTCTCTTGCGGTGG - Intergenic
1160972482 19:1775683-1775705 CACTCCCTCCCCTCCGGGGGGGG - Exonic
1161949651 19:7460655-7460677 GTCTGGCTCCTCTCGAGGTGTGG + Intronic
1162328452 19:10012193-10012215 GTCTCCCTCTTCCCCTGGGGCGG - Intergenic
1163176392 19:15566688-15566710 GCTTCTCTCCTCTCGGGGTGGGG + Intergenic
1163700850 19:18785845-18785867 GTCTCCCACCTCTCAGGGGACGG - Exonic
1164444412 19:28305029-28305051 GTGTCCCTACTCCCAGGGGGAGG - Intergenic
1165131570 19:33635563-33635585 GCCTCCCTCCTCTGTGGAGGAGG - Intronic
1166367406 19:42284480-42284502 GCCTCCCGCCGCCCGGGGGGCGG - Intronic
1167211726 19:48137741-48137763 GTCTCCCTTCTCTCGCGGCCTGG + Intronic
1167767257 19:51491743-51491765 CTCTCCTTCCTCTGGGGAGGGGG + Exonic
925688453 2:6495841-6495863 GGCTGCCTCCTCTCGGGCCGGGG + Intergenic
932218166 2:69980020-69980042 GGCTCCCTGCTCTCTGGGGCAGG - Intergenic
935246538 2:101223761-101223783 GTCTCCCTGCTCTGGGGAGTGGG + Intronic
937264838 2:120608889-120608911 GTCTCACTCCTGGCTGGGGGTGG + Intergenic
938341526 2:130539562-130539584 GTCTCCCTCCTCCCTGGGCAGGG - Exonic
938348304 2:130581147-130581169 GTCTCCCTCCTCCCTGGGCAGGG + Intronic
944743506 2:202634786-202634808 CGCTCCCTCCCCGCGGGGGGCGG + Intergenic
945069601 2:205977200-205977222 GGCTCCCTCAGCTCGCGGGGAGG + Intergenic
948164320 2:235849801-235849823 GTCTTCCTCCCCTCCAGGGGCGG - Intronic
948609426 2:239157341-239157363 GTCACCTCCCTCTCTGGGGGAGG + Intronic
1168914223 20:1473137-1473159 GTCTGTCTTCTCTCGGGAGGAGG + Intronic
1171997019 20:31739388-31739410 GTCTCCCTCCTCCCGGAGTTTGG + Exonic
1175529804 20:59666768-59666790 GTCCCCTTCCTCTCCGGGAGTGG - Intronic
1175840367 20:62022708-62022730 CTCTCCCACCTCTCGGGGTTTGG + Intronic
1176053049 20:63130710-63130732 GATTCCCTTCTCTCGGGGAGGGG - Intergenic
1178695987 21:34792938-34792960 GTCTCCGTCCTCTCAGGAGGTGG - Intronic
1183169916 22:36180262-36180284 GTTTCCCTCCGCTCTGGGGCGGG + Intergenic
1183417101 22:37688838-37688860 ATCTGCCTCCTCTGTGGGGGTGG - Exonic
950952594 3:17016452-17016474 GCCTCCCTCCTCTCTGCAGGAGG - Intronic
954138714 3:48594296-48594318 GTCTCCTCCCTCTCTGGGGAAGG + Intronic
954226237 3:49183006-49183028 GGCTCCCTCAGCTCGCGGGGAGG - Intronic
961465087 3:127076631-127076653 GGCTCCCTCAGCTTGGGGGGAGG - Intergenic
964786358 3:160400244-160400266 GTCTCCCTCCTCTCAGCGGTCGG - Intronic
965604328 3:170484231-170484253 ATCTCCCTCTTCTCTGGGGGTGG - Intronic
966923521 3:184629790-184629812 TTCTCCCGCCTGTCGGGGGTAGG + Intronic
967916730 3:194583932-194583954 CTCTCGCTCCTCGCGGGAGGCGG + Intergenic
968491551 4:893044-893066 GCCACCCTCCTCTCTGTGGGGGG + Intronic
968585686 4:1414929-1414951 GCCCCCCTCCTCTCGGCGGTTGG + Intergenic
968618938 4:1595012-1595034 GTCTCCATCCTGTGGGGGGATGG - Intergenic
969265640 4:6062417-6062439 GTCAGCCTCCTCTCGGGCTGTGG + Exonic
969705462 4:8789067-8789089 GTCTCCCTCCTCCCGGTCTGTGG - Intergenic
972178998 4:36441676-36441698 CTTTCCCTCCTCTCGGGGACAGG + Intergenic
972784672 4:42315447-42315469 GGCTCCCTCTGCTCGCGGGGAGG - Intergenic
973945220 4:55948694-55948716 CTCTTCCTCCTGTCGGCGGGAGG - Intergenic
979443243 4:120777946-120777968 GTCTCCCTCCTCTTTTGGGGAGG - Intronic
980739218 4:136928977-136928999 GGCTCCCTCATCTTGGGGGGAGG + Intergenic
980809205 4:137853598-137853620 GGCTCCCTCTGCTCGCGGGGAGG + Intergenic
982293772 4:153806239-153806261 GGCTCCCTCTGCTCGCGGGGAGG + Intergenic
984538925 4:181013041-181013063 GTCACCCTCCTCTCCCTGGGAGG - Intergenic
985660057 5:1152528-1152550 GTCTCCCTTCTCTAGGGGATGGG - Intergenic
988495053 5:31737698-31737720 TTCTCCTTCCTCTGGTGGGGAGG + Intronic
997756696 5:136406335-136406357 GCATCCCTCCTCTTGGGAGGAGG + Intergenic
997759475 5:136431324-136431346 CTCTCCCTCCTCCCTGGGGCTGG + Intergenic
998071122 5:139198517-139198539 GTGCCCCTCCCCTTGGGGGGAGG + Intronic
1001492316 5:172164636-172164658 GTCTCCCCCCTATATGGGGGAGG + Intronic
1002081412 5:176739809-176739831 ATCTCCCTCCTCTGGAGGGGAGG + Intergenic
1003490823 6:6620056-6620078 GTCTTCCTCCTCTCAGGGGAAGG - Intronic
1005935503 6:30517939-30517961 GTCTCCCTCTGCTTGGGGGGAGG + Intergenic
1007176767 6:39902478-39902500 GACTCCCTTCTCTCAAGGGGAGG + Exonic
1007662726 6:43496494-43496516 TTCTGCCTCCTGTCAGGGGGAGG + Intronic
1011189273 6:84713282-84713304 CTTTCCCTCCTCTCGGGGACAGG + Intronic
1016183482 6:141175065-141175087 GGCTCCCTCTTCTCGTGGGGAGG + Intergenic
1016184649 6:141183487-141183509 GGCTCCCTCTGCTCGTGGGGAGG + Intergenic
1017205450 6:151800263-151800285 CTCTCCCTCCTCTCAGGTGTGGG - Intronic
1018400485 6:163415130-163415152 CCCTCCCTCCTCTCCGGCGGCGG + Exonic
1019597058 7:1863096-1863118 GGCTCCCTCCTCTGGTTGGGGGG - Intronic
1019706144 7:2498125-2498147 GTCCCCCTCAACTCTGGGGGAGG - Intergenic
1019767567 7:2863115-2863137 GTCTTCCTCCTCTCCCAGGGTGG + Intergenic
1020224799 7:6272160-6272182 GTGTCGCTCCTCTGGGGCGGGGG - Intronic
1022519076 7:30994391-30994413 CACTCCCTCTTCTCGTGGGGAGG - Intergenic
1024281702 7:47724227-47724249 GTCTCACTCCTCTAGGGGTATGG - Intronic
1026458060 7:70589965-70589987 CTCTCCCTCCTCCTGGGGAGGGG - Intronic
1026460767 7:70613499-70613521 GTCTCCCTCCTCCCAGGCTGGGG + Intronic
1028442440 7:90879880-90879902 GTCTCCCTTCTCTGGGGAGTGGG - Intronic
1028816947 7:95157259-95157281 GTATCCCTGCACTCTGGGGGGGG - Intronic
1031471816 7:122175973-122175995 CTTTCCCTCCTCTCAGGGAGAGG - Intergenic
1031846062 7:126806889-126806911 GGCTCCCTCTGCTCGCGGGGAGG - Intronic
1032983012 7:137306503-137306525 CTCTCCCTGCTCCCAGGGGGTGG - Intronic
1033742358 7:144284763-144284785 GTGTCCCTCCTCTGTGGGGGAGG + Intergenic
1033751544 7:144364851-144364873 GTGTCCCTCCTCTGTGGGGGAGG - Exonic
1033839968 7:145361024-145361046 GGCTCCCTCCACTTGCGGGGAGG - Intergenic
1034622063 7:152464018-152464040 GTCTCCCTCCTCTCGGGGGGAGG - Intergenic
1035659083 8:1333337-1333359 GTCTCCCTTCCCTGGGGAGGAGG + Intergenic
1036239926 8:7072964-7072986 GTCTACCTACTCTGGGTGGGTGG + Intergenic
1036398488 8:8387549-8387571 ATCTTCCTCCTCTCAGTGGGTGG - Intergenic
1037890906 8:22623301-22623323 GTCTCCTTCCACTCGGGGACGGG - Intronic
1038840252 8:31177901-31177923 ATCTCCCTCCCCTTGGGGGGCGG + Intergenic
1041004920 8:53488274-53488296 GTCTCCCTCAGCCCAGGGGGTGG + Intergenic
1043161814 8:76855359-76855381 GTTTCCCTCGTCTCCGGTGGTGG - Exonic
1057296914 9:93851714-93851736 GGCTGCCTCCTCTCTGGGGTAGG + Intergenic
1057851148 9:98567868-98567890 GTCTCCCTCTTTTGGGGTGGTGG + Intronic
1058072846 9:100619303-100619325 GACTCCCTCCTCTCTGGGAAAGG - Intergenic
1060663182 9:125416223-125416245 GTCTCCCTCCACTGGCAGGGAGG - Intergenic
1061451161 9:130667605-130667627 ATCTCCCTCCTCTGGAGGGCTGG + Intronic
1061957992 9:133973532-133973554 GTCTCCTTCCTCTCTGGGAGTGG - Intronic
1186870241 X:13764477-13764499 GTCTCCCTCCACCCGCAGGGAGG - Intronic
1187648270 X:21373949-21373971 GTCCCCCTCCCCTCGGTGGTGGG + Intergenic
1187969737 X:24647518-24647540 GTCTCCGTCCTCTCTGGGCACGG + Intronic
1188117525 X:26263558-26263580 TTCTCCCTCCCCTCAGGGGTTGG - Intergenic
1189946812 X:46188404-46188426 CTTTCCCTCCTCTCGGGGACAGG - Intergenic
1190903162 X:54698221-54698243 GTCTGCCCCTACTCGGGGGGGGG - Intergenic
1191602018 X:63018613-63018635 GTCTGCCTCTACTGGGGGGGGGG - Intergenic
1193170874 X:78333989-78334011 CTCTACCTCCTCTAGGGGAGGGG - Intergenic
1200173776 X:154097690-154097712 CGCTCCCTCCTCTCGGAGAGAGG - Exonic
1200906036 Y:8484113-8484135 ATCTCCTTCCTCTAGTGGGGTGG - Intergenic