ID: 1034622865

View in Genome Browser
Species Human (GRCh38)
Location 7:152469790-152469812
Sequence CTGGGGAAGCCTCAGAATCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 18015
Summary {0: 61, 1: 1957, 2: 6404, 3: 6025, 4: 3568}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034622865_1034622873 28 Left 1034622865 7:152469790-152469812 CCGTGATTCTGAGGCTTCCCCAG 0: 61
1: 1957
2: 6404
3: 6025
4: 3568
Right 1034622873 7:152469841-152469863 CTCTTTCTGTTCCTAGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034622865 Original CRISPR CTGGGGAAGCCTCAGAATCA CGG (reversed) Intergenic
Too many off-targets to display for this crispr