ID: 1034622867

View in Genome Browser
Species Human (GRCh38)
Location 7:152469807-152469829
Sequence CTTACAGTTCCACATGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27734
Summary {0: 1791, 1: 5734, 2: 7090, 3: 7321, 4: 5798}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034622867_1034622873 11 Left 1034622867 7:152469807-152469829 CCCCAGCCATGTGGAACTGTAAG 0: 1791
1: 5734
2: 7090
3: 7321
4: 5798
Right 1034622873 7:152469841-152469863 CTCTTTCTGTTCCTAGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034622867 Original CRISPR CTTACAGTTCCACATGGCTG GGG (reversed) Intergenic
Too many off-targets to display for this crispr