ID: 1034622868

View in Genome Browser
Species Human (GRCh38)
Location 7:152469808-152469830
Sequence ACTTACAGTTCCACATGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27761
Summary {0: 1916, 1: 5849, 2: 7136, 3: 7378, 4: 5482}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034622868_1034622873 10 Left 1034622868 7:152469808-152469830 CCCAGCCATGTGGAACTGTAAGT 0: 1916
1: 5849
2: 7136
3: 7378
4: 5482
Right 1034622873 7:152469841-152469863 CTCTTTCTGTTCCTAGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034622868 Original CRISPR ACTTACAGTTCCACATGGCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr