ID: 1034622869

View in Genome Browser
Species Human (GRCh38)
Location 7:152469809-152469831
Sequence GACTTACAGTTCCACATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26821
Summary {0: 1834, 1: 5465, 2: 6859, 3: 7257, 4: 5406}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034622869_1034622873 9 Left 1034622869 7:152469809-152469831 CCAGCCATGTGGAACTGTAAGTC 0: 1834
1: 5465
2: 6859
3: 7257
4: 5406
Right 1034622873 7:152469841-152469863 CTCTTTCTGTTCCTAGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034622869 Original CRISPR GACTTACAGTTCCACATGGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr