ID: 1034622870

View in Genome Browser
Species Human (GRCh38)
Location 7:152469813-152469835
Sequence ATTGGACTTACAGTTCCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 20148
Summary {0: 1298, 1: 2452, 2: 4016, 3: 6253, 4: 6129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034622870_1034622873 5 Left 1034622870 7:152469813-152469835 CCATGTGGAACTGTAAGTCCAAT 0: 1298
1: 2452
2: 4016
3: 6253
4: 6129
Right 1034622873 7:152469841-152469863 CTCTTTCTGTTCCTAGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034622870 Original CRISPR ATTGGACTTACAGTTCCACA TGG (reversed) Intergenic
Too many off-targets to display for this crispr