ID: 1034622873

View in Genome Browser
Species Human (GRCh38)
Location 7:152469841-152469863
Sequence CTCTTTCTGTTCCTAGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034622870_1034622873 5 Left 1034622870 7:152469813-152469835 CCATGTGGAACTGTAAGTCCAAT 0: 1298
1: 2452
2: 4016
3: 6253
4: 6129
Right 1034622873 7:152469841-152469863 CTCTTTCTGTTCCTAGTTTCTGG No data
1034622867_1034622873 11 Left 1034622867 7:152469807-152469829 CCCCAGCCATGTGGAACTGTAAG 0: 1791
1: 5734
2: 7090
3: 7321
4: 5798
Right 1034622873 7:152469841-152469863 CTCTTTCTGTTCCTAGTTTCTGG No data
1034622869_1034622873 9 Left 1034622869 7:152469809-152469831 CCAGCCATGTGGAACTGTAAGTC 0: 1834
1: 5465
2: 6859
3: 7257
4: 5406
Right 1034622873 7:152469841-152469863 CTCTTTCTGTTCCTAGTTTCTGG No data
1034622868_1034622873 10 Left 1034622868 7:152469808-152469830 CCCAGCCATGTGGAACTGTAAGT 0: 1916
1: 5849
2: 7136
3: 7378
4: 5482
Right 1034622873 7:152469841-152469863 CTCTTTCTGTTCCTAGTTTCTGG No data
1034622865_1034622873 28 Left 1034622865 7:152469790-152469812 CCGTGATTCTGAGGCTTCCCCAG 0: 61
1: 1957
2: 6404
3: 6025
4: 3568
Right 1034622873 7:152469841-152469863 CTCTTTCTGTTCCTAGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034622873 Original CRISPR CTCTTTCTGTTCCTAGTTTC TGG Intergenic
No off target data available for this crispr