ID: 1034626209

View in Genome Browser
Species Human (GRCh38)
Location 7:152494770-152494792
Sequence TATAAGGCAGAGAACTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034626206_1034626209 -6 Left 1034626206 7:152494753-152494775 CCAAGGCAGGCAGAGTTTATAAG No data
Right 1034626209 7:152494770-152494792 TATAAGGCAGAGAACTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034626209 Original CRISPR TATAAGGCAGAGAACTGGAG AGG Intergenic
No off target data available for this crispr