ID: 1034630128

View in Genome Browser
Species Human (GRCh38)
Location 7:152524265-152524287
Sequence GGTAGCTTCATGGCAGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034630128_1034630136 15 Left 1034630128 7:152524265-152524287 CCTGGCCCTGCCATGAAGCTACC No data
Right 1034630136 7:152524303-152524325 ACATTCCTACACACAGAGCCTGG No data
1034630128_1034630134 -10 Left 1034630128 7:152524265-152524287 CCTGGCCCTGCCATGAAGCTACC No data
Right 1034630134 7:152524278-152524300 TGAAGCTACCAGGAGGTGATCGG No data
1034630128_1034630137 16 Left 1034630128 7:152524265-152524287 CCTGGCCCTGCCATGAAGCTACC No data
Right 1034630137 7:152524304-152524326 CATTCCTACACACAGAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034630128 Original CRISPR GGTAGCTTCATGGCAGGGCC AGG (reversed) Intergenic
No off target data available for this crispr