ID: 1034630131

View in Genome Browser
Species Human (GRCh38)
Location 7:152524271-152524293
Sequence CCTCCTGGTAGCTTCATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034630131_1034630137 10 Left 1034630131 7:152524271-152524293 CCTGCCATGAAGCTACCAGGAGG No data
Right 1034630137 7:152524304-152524326 CATTCCTACACACAGAGCCTGGG No data
1034630131_1034630136 9 Left 1034630131 7:152524271-152524293 CCTGCCATGAAGCTACCAGGAGG No data
Right 1034630136 7:152524303-152524325 ACATTCCTACACACAGAGCCTGG No data
1034630131_1034630140 28 Left 1034630131 7:152524271-152524293 CCTGCCATGAAGCTACCAGGAGG No data
Right 1034630140 7:152524322-152524344 CTGGGCTCGCTTTGCTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034630131 Original CRISPR CCTCCTGGTAGCTTCATGGC AGG (reversed) Intergenic
No off target data available for this crispr