ID: 1034630135

View in Genome Browser
Species Human (GRCh38)
Location 7:152524286-152524308
Sequence GAATGTGACCGATCACCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034630135_1034630142 18 Left 1034630135 7:152524286-152524308 CCAGGAGGTGATCGGTCACATTC No data
Right 1034630142 7:152524327-152524349 CTCGCTTTGCTTTCATGGCAGGG No data
1034630135_1034630144 26 Left 1034630135 7:152524286-152524308 CCAGGAGGTGATCGGTCACATTC No data
Right 1034630144 7:152524335-152524357 GCTTTCATGGCAGGGGACAGAGG No data
1034630135_1034630137 -5 Left 1034630135 7:152524286-152524308 CCAGGAGGTGATCGGTCACATTC No data
Right 1034630137 7:152524304-152524326 CATTCCTACACACAGAGCCTGGG No data
1034630135_1034630143 19 Left 1034630135 7:152524286-152524308 CCAGGAGGTGATCGGTCACATTC No data
Right 1034630143 7:152524328-152524350 TCGCTTTGCTTTCATGGCAGGGG No data
1034630135_1034630140 13 Left 1034630135 7:152524286-152524308 CCAGGAGGTGATCGGTCACATTC No data
Right 1034630140 7:152524322-152524344 CTGGGCTCGCTTTGCTTTCATGG No data
1034630135_1034630141 17 Left 1034630135 7:152524286-152524308 CCAGGAGGTGATCGGTCACATTC No data
Right 1034630141 7:152524326-152524348 GCTCGCTTTGCTTTCATGGCAGG No data
1034630135_1034630136 -6 Left 1034630135 7:152524286-152524308 CCAGGAGGTGATCGGTCACATTC No data
Right 1034630136 7:152524303-152524325 ACATTCCTACACACAGAGCCTGG No data
1034630135_1034630145 30 Left 1034630135 7:152524286-152524308 CCAGGAGGTGATCGGTCACATTC No data
Right 1034630145 7:152524339-152524361 TCATGGCAGGGGACAGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034630135 Original CRISPR GAATGTGACCGATCACCTCC TGG (reversed) Intergenic
No off target data available for this crispr