ID: 1034630136

View in Genome Browser
Species Human (GRCh38)
Location 7:152524303-152524325
Sequence ACATTCCTACACACAGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034630135_1034630136 -6 Left 1034630135 7:152524286-152524308 CCAGGAGGTGATCGGTCACATTC No data
Right 1034630136 7:152524303-152524325 ACATTCCTACACACAGAGCCTGG No data
1034630128_1034630136 15 Left 1034630128 7:152524265-152524287 CCTGGCCCTGCCATGAAGCTACC No data
Right 1034630136 7:152524303-152524325 ACATTCCTACACACAGAGCCTGG No data
1034630131_1034630136 9 Left 1034630131 7:152524271-152524293 CCTGCCATGAAGCTACCAGGAGG No data
Right 1034630136 7:152524303-152524325 ACATTCCTACACACAGAGCCTGG No data
1034630130_1034630136 10 Left 1034630130 7:152524270-152524292 CCCTGCCATGAAGCTACCAGGAG No data
Right 1034630136 7:152524303-152524325 ACATTCCTACACACAGAGCCTGG No data
1034630133_1034630136 5 Left 1034630133 7:152524275-152524297 CCATGAAGCTACCAGGAGGTGAT No data
Right 1034630136 7:152524303-152524325 ACATTCCTACACACAGAGCCTGG No data
1034630127_1034630136 16 Left 1034630127 7:152524264-152524286 CCCTGGCCCTGCCATGAAGCTAC No data
Right 1034630136 7:152524303-152524325 ACATTCCTACACACAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034630136 Original CRISPR ACATTCCTACACACAGAGCC TGG Intergenic
No off target data available for this crispr