ID: 1034630317

View in Genome Browser
Species Human (GRCh38)
Location 7:152525452-152525474
Sequence CAGTCACGTATCACCACGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034630317_1034630322 8 Left 1034630317 7:152525452-152525474 CCAGGCGTGGTGATACGTGACTG No data
Right 1034630322 7:152525483-152525505 GCTACTTAGGAAGCTGAGGCAGG 0: 165
1: 10198
2: 172474
3: 265994
4: 180251
1034630317_1034630320 4 Left 1034630317 7:152525452-152525474 CCAGGCGTGGTGATACGTGACTG No data
Right 1034630320 7:152525479-152525501 CCCAGCTACTTAGGAAGCTGAGG 0: 241
1: 13426
2: 205941
3: 299759
4: 190058
1034630317_1034630318 -5 Left 1034630317 7:152525452-152525474 CCAGGCGTGGTGATACGTGACTG No data
Right 1034630318 7:152525470-152525492 GACTGTAGTCCCAGCTACTTAGG 0: 315
1: 32946
2: 164695
3: 263863
4: 223594
1034630317_1034630324 27 Left 1034630317 7:152525452-152525474 CCAGGCGTGGTGATACGTGACTG No data
Right 1034630324 7:152525502-152525524 CAGGAGAATCACTTGAACCTGGG 0: 19726
1: 81126
2: 140864
3: 165550
4: 182302
1034630317_1034630323 26 Left 1034630317 7:152525452-152525474 CCAGGCGTGGTGATACGTGACTG No data
Right 1034630323 7:152525501-152525523 GCAGGAGAATCACTTGAACCTGG 0: 33779
1: 81745
2: 101616
3: 124160
4: 74442
1034630317_1034630325 30 Left 1034630317 7:152525452-152525474 CCAGGCGTGGTGATACGTGACTG No data
Right 1034630325 7:152525505-152525527 GAGAATCACTTGAACCTGGGAGG 0: 20599
1: 62494
2: 120157
3: 154110
4: 162194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034630317 Original CRISPR CAGTCACGTATCACCACGCC TGG (reversed) Intergenic
No off target data available for this crispr