ID: 1034634975

View in Genome Browser
Species Human (GRCh38)
Location 7:152559976-152559998
Sequence TTGCCTGTTTATGTGTTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034634975_1034634976 18 Left 1034634975 7:152559976-152559998 CCAGGCAACACATAAACAGGCAA No data
Right 1034634976 7:152560017-152560039 AAACACATTTTTAAAAGTGATGG No data
1034634975_1034634977 25 Left 1034634975 7:152559976-152559998 CCAGGCAACACATAAACAGGCAA No data
Right 1034634977 7:152560024-152560046 TTTTTAAAAGTGATGGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034634975 Original CRISPR TTGCCTGTTTATGTGTTGCC TGG (reversed) Intergenic
No off target data available for this crispr