ID: 1034636304

View in Genome Browser
Species Human (GRCh38)
Location 7:152569940-152569962
Sequence CAGAAGAGCTGGCAAACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034636304_1034636309 10 Left 1034636304 7:152569940-152569962 CCATGGGTTTGCCAGCTCTTCTG No data
Right 1034636309 7:152569973-152569995 AGGCATTTCTGGTAAGATGGTGG No data
1034636304_1034636306 -10 Left 1034636304 7:152569940-152569962 CCATGGGTTTGCCAGCTCTTCTG No data
Right 1034636306 7:152569953-152569975 AGCTCTTCTGTTTTTTTCTCAGG No data
1034636304_1034636307 -1 Left 1034636304 7:152569940-152569962 CCATGGGTTTGCCAGCTCTTCTG No data
Right 1034636307 7:152569962-152569984 GTTTTTTTCTCAGGCATTTCTGG No data
1034636304_1034636310 13 Left 1034636304 7:152569940-152569962 CCATGGGTTTGCCAGCTCTTCTG No data
Right 1034636310 7:152569976-152569998 CATTTCTGGTAAGATGGTGGTGG No data
1034636304_1034636308 7 Left 1034636304 7:152569940-152569962 CCATGGGTTTGCCAGCTCTTCTG No data
Right 1034636308 7:152569970-152569992 CTCAGGCATTTCTGGTAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034636304 Original CRISPR CAGAAGAGCTGGCAAACCCA TGG (reversed) Intergenic