ID: 1034637199

View in Genome Browser
Species Human (GRCh38)
Location 7:152576821-152576843
Sequence CTCCTGCCCTTAAGGAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034637195_1034637199 -4 Left 1034637195 7:152576802-152576824 CCTTGCTTTCCGTACGTTTCTCC No data
Right 1034637199 7:152576821-152576843 CTCCTGCCCTTAAGGAAAAAGGG No data
1034637194_1034637199 8 Left 1034637194 7:152576790-152576812 CCTAAAGCTCTTCCTTGCTTTCC No data
Right 1034637199 7:152576821-152576843 CTCCTGCCCTTAAGGAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034637199 Original CRISPR CTCCTGCCCTTAAGGAAAAA GGG Intergenic
No off target data available for this crispr