ID: 1034643720

View in Genome Browser
Species Human (GRCh38)
Location 7:152625777-152625799
Sequence TTCATCAATTGCCCAGTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034643720_1034643722 -6 Left 1034643720 7:152625777-152625799 CCTGAGACTGGGCAATTGATGAA No data
Right 1034643722 7:152625794-152625816 GATGAAAAAAGAGGTTTAATTGG No data
1034643720_1034643726 19 Left 1034643720 7:152625777-152625799 CCTGAGACTGGGCAATTGATGAA No data
Right 1034643726 7:152625819-152625841 CAGGGATGTGCAGGCTGTACAGG No data
1034643720_1034643723 0 Left 1034643720 7:152625777-152625799 CCTGAGACTGGGCAATTGATGAA No data
Right 1034643723 7:152625800-152625822 AAAAGAGGTTTAATTGGCTCAGG 0: 36
1: 92
2: 116
3: 126
4: 280
1034643720_1034643725 10 Left 1034643720 7:152625777-152625799 CCTGAGACTGGGCAATTGATGAA No data
Right 1034643725 7:152625810-152625832 TAATTGGCTCAGGGATGTGCAGG No data
1034643720_1034643724 1 Left 1034643720 7:152625777-152625799 CCTGAGACTGGGCAATTGATGAA No data
Right 1034643724 7:152625801-152625823 AAAGAGGTTTAATTGGCTCAGGG 0: 1146
1: 2351
2: 2552
3: 1938
4: 1551

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034643720 Original CRISPR TTCATCAATTGCCCAGTCTC AGG (reversed) Intergenic
No off target data available for this crispr