ID: 1034643726

View in Genome Browser
Species Human (GRCh38)
Location 7:152625819-152625841
Sequence CAGGGATGTGCAGGCTGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034643720_1034643726 19 Left 1034643720 7:152625777-152625799 CCTGAGACTGGGCAATTGATGAA No data
Right 1034643726 7:152625819-152625841 CAGGGATGTGCAGGCTGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034643726 Original CRISPR CAGGGATGTGCAGGCTGTAC AGG Intergenic
No off target data available for this crispr