ID: 1034645811

View in Genome Browser
Species Human (GRCh38)
Location 7:152646208-152646230
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 2, 1: 8, 2: 12, 3: 45, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034645811 Original CRISPR CTAAGGTCCTTGCATTGTCC GGG (reversed) Intronic
900469076 1:2842963-2842985 CTAAAGTACTTGCCTTGTCTTGG - Intergenic
901950077 1:12737739-12737761 CTAAGGTCCTTGAGTTTTCTGGG + Intergenic
902088519 1:13882932-13882954 CTAAGGTCCTTGCATTGTCCAGG - Intergenic
902981321 1:20125489-20125511 CTAAGGTTTGTGCATTTTCCTGG + Intergenic
903368869 1:22821986-22822008 CTAAGGTCCTTGGATGATGCTGG + Intronic
903625062 1:24724686-24724708 ATCAGCTCCTTGCATTGTCTTGG - Intergenic
903638276 1:24835653-24835675 CTAAGGTCTTTGCATTATCCTGG + Intronic
905751995 1:40473424-40473446 CTAAGATGCTTGCTTTCTCCAGG + Intergenic
906574799 1:46878667-46878689 GTAAGATCCTTGCATTTTCAGGG + Intergenic
906597174 1:47089236-47089258 GTAAGATCCTTGCATTTTCAGGG - Intronic
907315126 1:53564229-53564251 CTAAGGTTCTTGTATTGTTGGGG + Intronic
907690317 1:56658045-56658067 CTAAAGTCCTTGCTTTGTTTGGG + Intronic
907950669 1:59180208-59180230 CTGAGATCCTTGCATTTTTCTGG + Intergenic
911763040 1:101638740-101638762 GTAATGTCCTTGCAATGTCCAGG - Intergenic
911798450 1:102103824-102103846 CTAAGTTCCTTCCAAAGTCCAGG + Intergenic
911889192 1:103345250-103345272 CTAAGTTCCTTGGAATTTCCTGG - Intergenic
913059497 1:115191843-115191865 CCAAGTTCCTTGATTTGTCCTGG + Intergenic
913133641 1:115865591-115865613 CTAAGGTCCTTCCTTCCTCCGGG - Intergenic
913329178 1:117653152-117653174 CCTAGGACATTGCATTGTCCTGG - Intergenic
913993326 1:143635071-143635093 CTAAGGCCCCTGCTCTGTCCTGG - Intergenic
916821902 1:168407653-168407675 CTAAGGTCTTTACATTGTCTAGG + Intergenic
917541142 1:175915892-175915914 CTATAGTCCTTCCAATGTCCTGG + Intergenic
917571217 1:176267210-176267232 CTAAGGCCTTTGTATTGTCCTGG + Intergenic
917592274 1:176488615-176488637 CTATGGGCCTTCCATTGTGCTGG - Intronic
918310496 1:183282066-183282088 CTCAGGTCCTGGCATGGTCCAGG - Intronic
918653075 1:186990024-186990046 CTAAGGACCTTGCATTCTGGTGG + Intergenic
919741645 1:200984640-200984662 CTGAGGTCCTGGCATTCTCAGGG + Intronic
920121098 1:203659052-203659074 CTAAGGTCCTTATATTTTCTAGG + Intronic
923067761 1:230535477-230535499 CTAAGGTCTTTGCATTGTCCAGG + Intergenic
923082925 1:230676446-230676468 CTAAGTTCCGCGTATTGTCCAGG - Intronic
924301224 1:242640110-242640132 CTTATGTACTTGCATTGTCTTGG - Intergenic
1063961794 10:11312492-11312514 CTCAGATCCTTGAATTGTTCTGG + Intronic
1065803288 10:29372110-29372132 CAAAATTCCTTGCATTGCCCAGG + Intergenic
1071300591 10:84253410-84253432 TTAAGGTCCTTGCATTGGGAGGG + Intronic
1072057316 10:91772827-91772849 CTAAAGTACTAGCATTGTCAGGG - Intergenic
1073695573 10:105862912-105862934 ATGAGGTTCTGGCATTGTCCAGG + Intergenic
1075787681 10:125061154-125061176 CTAAGGCCCTGGCATTGTCTAGG + Intronic
1076179747 10:128397907-128397929 CTCAGGTCCCTGCAATGCCCAGG - Intergenic
1076246303 10:128950142-128950164 CTAAGGAGCTTGGAGTGTCCAGG - Intergenic
1078411971 11:11130974-11130996 CTAAGTTCCTTGTATTGATCAGG + Intergenic
1078863292 11:15273206-15273228 CTAAGATCCTTGCAATGTTTGGG - Intergenic
1079208244 11:18436784-18436806 CTAAGATCTTTGTATTATCCCGG - Intronic
1079433541 11:20421362-20421384 TTAATGTCCTTGCATTGTCTGGG - Intronic
1080063858 11:27986534-27986556 CTATGATCCTTGCATTATCCTGG + Intergenic
1080325427 11:31066525-31066547 CTAAGGTACTTACATTGTTCTGG + Intronic
1080594724 11:33761043-33761065 CTAAAGTTCTTTCATTGTCCAGG + Intronic
1080831528 11:35897588-35897610 CTAAGGTTCTTCCATTGTCCAGG + Intergenic
1083719667 11:64598113-64598135 CCAAGGTCCTGGCAGTGGCCAGG + Intronic
1085033578 11:73287194-73287216 CTAAGTTCCAGGCATTGTCCTGG - Intronic
1086268732 11:85034023-85034045 CCATGGTTCTTGCATTTTCCTGG - Intronic
1087979044 11:104587911-104587933 GTAAGGTCCTTGCATTGTCCAGG + Intergenic
1088252806 11:107876190-107876212 CTAAGGTTCTTGCATTGTTTGGG - Intronic
1088388448 11:109287065-109287087 CTAAGGTCACTGCATTATCCAGG + Intergenic
1092701200 12:11232771-11232793 CTAAGGCCCTTGCAGGGTCATGG + Intergenic
1095381530 12:41599974-41599996 CTAAGTTCCTTTCATTGTTTGGG - Intergenic
1098353320 12:69585746-69585768 CCTAGGTCTTTGCATAGTCCCGG + Intronic
1098607498 12:72409903-72409925 TGAAGGTCCTTGCATTATCCAGG + Intronic
1099270856 12:80508389-80508411 CTTAGGTCCTTCTTTTGTCCTGG - Intronic
1102090778 12:110185521-110185543 TTTAGGTTCTTGCATTGCCCAGG - Intronic
1104067700 12:125319074-125319096 CTCAGGTCCTGGTTTTGTCCTGG + Intronic
1105576060 13:21653268-21653290 CAAAGCTCCTTTCATTGTGCAGG - Intergenic
1107714224 13:43183301-43183323 TTAAAGTCCTTACATTGTCTGGG - Intergenic
1107797754 13:44070969-44070991 CCAAAGTCCTTTCATTGTCTGGG + Intergenic
1109050569 13:57476226-57476248 CTCAGGTCCTGGCTTTTTCCTGG + Intergenic
1111740836 13:92204360-92204382 CTAAGACCCTTGCAATGTCTGGG + Intronic
1114469520 14:22949831-22949853 CAAAGGTCCTTGTTTTGGCCGGG + Intronic
1114685315 14:24525260-24525282 CTAATGTTCTTGAATTCTCCAGG - Intergenic
1115653365 14:35419841-35419863 CTAAGGTCCCAGCATTGATCTGG - Intergenic
1115681729 14:35746799-35746821 CTAAGGTCCTTGTATTGATTAGG + Intronic
1117168479 14:53065984-53066006 CTAAGGACCATGAATTGTACCGG + Intronic
1117335827 14:54756494-54756516 CTAAGGTGCTTGCAGTTTCTGGG - Intronic
1118567327 14:67156412-67156434 TTAAGGTTCTTGTATTGTCTGGG + Intronic
1119116796 14:72030045-72030067 CTAAGATCTTCGCATTGTCTGGG + Intronic
1120700342 14:87692008-87692030 CTAAGAACCATGGATTGTCCAGG - Intergenic
1120903541 14:89598149-89598171 CTAAGTTCCTTGTAGTGTACAGG - Intronic
1121298244 14:92847717-92847739 CTAAGTTCCTTGCACTATTCTGG - Intergenic
1122926179 14:104902962-104902984 AGAAGGTCTTTACATTGTCCAGG - Intergenic
1123662896 15:22580796-22580818 CTAAGGTCTTTGCATTGTTTAGG - Intergenic
1124261389 15:28195126-28195148 CTAAGGTTTTTGCATTGTTTAGG + Intronic
1124316697 15:28675100-28675122 CTAAGGTCTTTGCATTGTTTAGG - Intergenic
1124500200 15:30221496-30221518 CTAAGGTCTTTGAATTATCCTGG + Intergenic
1124743375 15:32317170-32317192 CTAAGGTCTTTGAATTATCCTGG - Intergenic
1124871769 15:33550544-33550566 CTATGCTCCTTGCACTTTCCAGG - Intronic
1127146712 15:56032525-56032547 CTCAGGCCCAGGCATTGTCCTGG + Intergenic
1129585965 15:76865329-76865351 CTGACAGCCTTGCATTGTCCAGG + Intronic
1129662947 15:77563297-77563319 CTAAGGTTCTTGCATTCTTGAGG + Intergenic
1130113770 15:80988819-80988841 CTAAGGTGATTGTATCGTCCTGG - Intronic
1130128973 15:81120287-81120309 CTAAGAGCCATGCATTCTCCTGG - Intronic
1130290951 15:82600601-82600623 GTAAGGTCCTTGCATTTTCTAGG + Intronic
1130407472 15:83614576-83614598 CTCAGGTCCTTCCTATGTCCAGG - Intronic
1132096980 15:98993951-98993973 TTAAGGTCCTTGTATTCTACAGG - Intronic
1132124995 15:99215343-99215365 CAAAGGTCCTTGCATTGTTCAGG + Intronic
1135472690 16:22745627-22745649 CTGACATCTTTGCATTGTCCAGG - Intergenic
1138057502 16:53850648-53850670 CTAAGGTCCAGGCATTGTGCTGG + Intronic
1140766316 16:78161863-78161885 CTAAGGTTCTTGTCTTCTCCAGG - Intronic
1141051796 16:80772415-80772437 CTAAGGTCTCTGAATTGTCTGGG + Intronic
1143394622 17:6582837-6582859 CTAAGGTTCTTGCATTGTATGGG - Intronic
1145032478 17:19515385-19515407 CCAAGGTCTTTGCATGGCCCCGG + Intronic
1149025298 17:52020244-52020266 CTAAGAAGCTTGCATTGTTCAGG - Intronic
1153048395 18:877625-877647 ATAAGGTCCTTGGATTTTCCTGG + Intergenic
1155035378 18:22021106-22021128 CTCAGCTCATTGCAGTGTCCAGG - Intergenic
1155715093 18:28932622-28932644 GTAAGTTCCTGGCATTGTCATGG + Intergenic
1156838034 18:41579051-41579073 CTAAGGTCTTTGCACTTTCTGGG + Intergenic
1157215314 18:45777958-45777980 CTAAGGTCCTTGCATTGTCTGGG - Intergenic
1158122373 18:54062720-54062742 CTAATTGCCTTGCATTGTGCTGG + Intergenic
1158902558 18:61979502-61979524 GTAAGGTCTTTGCATTGTCCAGG - Intergenic
1159572356 18:70131424-70131446 CTAAGGTCCTTGCATTGTCTGGG + Intronic
1161060337 19:2211504-2211526 CTCAGGGCCTTGCAGTGCCCAGG + Intronic
1168423926 19:56223637-56223659 CCAGGGTCCCTGCATTGTCCAGG - Exonic
927384927 2:22521884-22521906 CTAAAGTCCTTGGAATCTCCAGG - Intergenic
928319197 2:30269669-30269691 CTAAGGACCTGGCTTTCTCCTGG + Intronic
929548079 2:42869489-42869511 CTAAGGTTCTTGCATTATCCAGG + Intergenic
930412492 2:51043188-51043210 TAAAAGTTCTTGCATTGTCCTGG - Intergenic
931302220 2:60991424-60991446 CCAAGGTCTTTGCATTCTCTGGG + Intronic
931792294 2:65674785-65674807 CTAAGGTCCTTGAATTGCTTGGG - Intergenic
935113826 2:100116601-100116623 CTAAGGTCCTTGAATTTTCCTGG - Intronic
937450741 2:122000422-122000444 CTAAGGGCATTGCATTATACTGG - Intergenic
939746895 2:145983886-145983908 CTAAAGTCCTTGCATTTTTATGG - Intergenic
939861274 2:147423303-147423325 TTAAAGTCCTTGTATTGTTCAGG - Intergenic
940124861 2:150311651-150311673 CCAACCTCCTTGCACTGTCCGGG - Intergenic
941812068 2:169765148-169765170 TTAAGGTTCTAGCATTGTCAGGG + Intronic
942480203 2:176378805-176378827 GTAAGGTCCTTACATTATTCAGG - Intergenic
944736845 2:202574770-202574792 CTTTGGTATTTGCATTGTCCTGG - Intergenic
944845637 2:203665235-203665257 CTATGGGCTTTGCATTGTCGAGG + Intergenic
946004780 2:216514552-216514574 CGAAGGTTCTTGCATTGTTCTGG + Intronic
948914459 2:241025445-241025467 CCAAGGTCATTGCATTTCCCAGG - Intronic
1169168602 20:3445275-3445297 CTAAGGTCCTTGCATTGCCCAGG + Intergenic
1169175525 20:3508849-3508871 TTAAGGTCCTTGAATTGCCCAGG + Intronic
1169512957 20:6284676-6284698 CTAAGGTCCTGGCATTGTCTGGG + Intergenic
1170400421 20:15977159-15977181 TAAAGGTCCTTGCAATGACCTGG + Intronic
1173949809 20:46982034-46982056 TTAAGGACCTTGCATTTTCTTGG - Intronic
1176087159 20:63303165-63303187 CTAAGGTCCTAGCGTTGCCTGGG - Intronic
1178290149 21:31360384-31360406 CTAATGTCCTTGTATTATCTAGG + Intronic
1178290152 21:31360411-31360433 CTAATGTCCTTGTATTATCTAGG + Intronic
1180058201 21:45370528-45370550 CAAAGGTCCTGGCGTTGTCTGGG - Intergenic
1180733090 22:17996615-17996637 CTCAGGTGCTTGGATTGCCCCGG - Intronic
1182707338 22:32293526-32293548 GTTAGGTCCTTGGATTGTCCAGG - Intergenic
1182788399 22:32927564-32927586 CTGAGGCCCTTGTATTGTCAGGG - Intronic
1183042014 22:35188415-35188437 CTAAGGCTCTTGCTTTGTTCAGG + Intergenic
1183054602 22:35296750-35296772 CTCAGATCTTTGCATTGTTCGGG + Intergenic
1183595760 22:38809512-38809534 CTAATGTCCTTACATTGTCCTGG - Intergenic
1184395682 22:44236920-44236942 GTTAGGTCCTCGGATTGTCCAGG - Intergenic
1185197160 22:49478928-49478950 CTAAGAACTTTGCATTGGCCAGG + Intronic
1185396387 22:50592947-50592969 CTCGGGTCCTTGTATTGTTCAGG + Intronic
950243859 3:11396856-11396878 CTAAGGTTCTTGCATTGTCTTGG + Intronic
950761305 3:15231000-15231022 ATAAGGGCCTTGCATTGTTAAGG + Intronic
951414506 3:22407675-22407697 CTATGCCCCTTGCTTTGTCCAGG + Intergenic
952045797 3:29318485-29318507 GTAAGGACCTTGCATTCTGCGGG - Intronic
952541635 3:34373316-34373338 CTAGTGTCCTTGAATTGACCTGG - Intergenic
952931298 3:38362986-38363008 CTCAAGTCCTAGCCTTGTCCGGG + Exonic
953541925 3:43828031-43828053 CTAAGGTCCTTCTGTTGTTCTGG + Intergenic
953781316 3:45873289-45873311 CTATGGGCCATGCATTGTACTGG + Intronic
955462675 3:59201711-59201733 CTAAAGTTACTGCATTGTCCAGG - Intergenic
960633403 3:119756637-119756659 CTAAGGCACTTGCATTGTTTAGG + Intronic
960918884 3:122726019-122726041 CAAAGGTCTTTGCATTGTCTGGG - Intronic
962459956 3:135601872-135601894 CTAAGGTCCTTGCATTATTTTGG + Intergenic
963827938 3:149974939-149974961 CTAAGGTTTTTGGATTGTCTAGG - Intronic
964023084 3:152038729-152038751 CTAAGTTCCTTCCAAAGTCCAGG - Intergenic
964610350 3:158607768-158607790 CTAAGGTCCTTGTATTCTTAAGG + Intergenic
966299928 3:178467166-178467188 CTAAGTACCTTGAAATGTCCAGG + Intronic
968819687 4:2841275-2841297 CTGAGGTCCTTATGTTGTCCAGG - Intergenic
969140997 4:5071650-5071672 CTAAGCTCCTTTGATTCTCCAGG - Intronic
979944098 4:126804255-126804277 CTAAGATCCTCACATTTTCCTGG - Intergenic
981003994 4:139856146-139856168 CCAAGTGCCTTGCATTGTGCTGG - Intronic
981506900 4:145511691-145511713 CTAAGGTCCTTGTGTTATCCAGG - Intronic
982386997 4:154817980-154818002 CTAAGTTCCTTGTATTATCTAGG - Intronic
988295228 5:29350139-29350161 CTAGGACCCTTGCATTGTCTAGG + Intergenic
990027348 5:51210345-51210367 CTAAGTTCTTTGCATTGTCTGGG - Intergenic
990686524 5:58308981-58309003 CTAAGGGCCTTGCACTCTCTAGG - Intergenic
993468302 5:88274522-88274544 CGCAGGTCCTTACATTGTCCTGG - Intergenic
994338049 5:98592152-98592174 CCAAGGCTCTTGCTTTGTCCAGG + Intergenic
994727998 5:103459219-103459241 AGAAGCTCCTTGAATTGTCCAGG + Intergenic
997641882 5:135454744-135454766 CCAAGGTCCTTGCATTGTCCAGG + Intergenic
1000656230 5:163881776-163881798 CTAAAACCCTTGCATTGTCCTGG + Intergenic
1001302456 5:170544796-170544818 GTAAAGTTCTTGCATTGTTCAGG - Intronic
1002165472 5:177341829-177341851 TTAGGATCCTTGCACTGTCCAGG + Intronic
1002545009 5:179935863-179935885 CTAACATGCTTGCATTGTCCAGG - Intronic
1003001126 6:2334780-2334802 CTGAGGTCCATTCATTGTCTAGG + Intergenic
1003056903 6:2829456-2829478 CTAAAGTCCTTGCATTGTCTGGG - Intergenic
1003056930 6:2829918-2829940 CTAAGGTCCTTGCATTGTCTGGG - Intergenic
1010747083 6:79576080-79576102 TTAAGGTCCTTGCATTGTTTAGG - Intergenic
1013335186 6:109151147-109151169 CTAATATCCTTGCATTTTCTTGG + Intronic
1015778555 6:136839851-136839873 CTGGGGTCCTTGCACTGTCTGGG + Intronic
1016153734 6:140777545-140777567 CTAAGTTGCTTACATTGCCCAGG + Intergenic
1016950504 6:149574919-149574941 CTAAGGTTCTTGCATTGTTTGGG - Intronic
1017540158 6:155393333-155393355 CCAAGATCCATGCATTGTTCAGG - Intergenic
1020352010 7:7230792-7230814 CTAAAGTCATTTCACTGTCCAGG - Intronic
1020714971 7:11661896-11661918 TTAAGGTCCTTGCATTTTCTAGG + Intronic
1023536013 7:41211798-41211820 CTAAGGTCCTTGCATATACTTGG - Intergenic
1023711787 7:43002254-43002276 CCAATATCCTTGCATTGCCCAGG - Intergenic
1023912651 7:44566669-44566691 CTAAGGTGCTCACATTCTCCTGG - Intronic
1025974498 7:66359114-66359136 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974536 7:66359300-66359322 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974548 7:66359360-66359382 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974561 7:66359423-66359445 CTAAGGTTCTTCAAGTGTCCAGG - Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1027714786 7:81656448-81656470 CTAGAGCCCTTGCATTGTCTTGG + Intergenic
1028160428 7:87478172-87478194 CTAAAATCATTGCATTGTCCTGG - Intronic
1031095032 7:117406844-117406866 CTAAGATTCCTGCATTGTCCAGG + Intronic
1033105774 7:138521354-138521376 CTAAGGTCCATGCATAGTCTAGG + Intronic
1033567213 7:142590917-142590939 CTAAGGTCTTTACACTTTCCAGG + Intergenic
1034645811 7:152646208-152646230 CTAAGGTCCTTGCATTGTCCGGG - Intronic
1036148471 8:6276068-6276090 CTCAAGGCCTGGCATTGTCCTGG - Intergenic
1037515082 8:19622616-19622638 TTAAAGCCCTTGCATTGTCCAGG + Intronic
1038654836 8:29440040-29440062 CTAAGGTCATTGCATTGTCTGGG + Intergenic
1039450308 8:37668457-37668479 GTGAGTTTCTTGCATTGTCCAGG + Intergenic
1041714302 8:60920333-60920355 CCAAGGTCCCTGCCTTCTCCAGG - Intergenic
1042402774 8:68368999-68369021 CTAAAATCCTTGCATTATCCAGG - Intronic
1042515402 8:69653812-69653834 CTAACGCCCTTGCAATCTCCAGG - Intronic
1043754147 8:83981397-83981419 TTAAAGTCCTTGCATTGTCAAGG + Intergenic
1044991014 8:97795892-97795914 CTAAGGTCCTTGCATTGTCTAGG - Intronic
1045355192 8:101380842-101380864 CTAAGGTTCTTGCATTACCTTGG - Intergenic
1045848999 8:106671458-106671480 TTAACATCCTTGCATTGTCTGGG + Intronic
1047428729 8:124771831-124771853 CGTAGGTCCTTGCATTTTCTGGG - Intergenic
1047535570 8:125716611-125716633 TCAAGGTCCTTGCATTTTTCAGG - Intergenic
1048024404 8:130571808-130571830 CTAAGAACTTTGCATTGACCTGG + Intergenic
1048081933 8:131138008-131138030 CTGAGGTACTGACATTGTCCTGG + Intergenic
1052814889 9:33094524-33094546 CCAAGGTTCTTGCACTATCCTGG + Intergenic
1053400233 9:37812953-37812975 CTAAGGTTCTTGCATCATCCAGG + Intronic
1055015270 9:71610137-71610159 CTAAGTTTGTTGCATTATCCTGG + Intergenic
1055644655 9:78351528-78351550 TTAAGGTTGTTGCATTGTTCTGG + Intergenic
1058015109 9:100022697-100022719 CTAAAGTCTTTGCATGGTCCAGG + Intronic
1059946610 9:119415016-119415038 TTATGATCCTTCCATTGTCCAGG - Intergenic
1059981744 9:119780582-119780604 CTAAGGCCCTTGTATTTTCCAGG + Intergenic
1060798490 9:126528328-126528350 CTAAGGCCCTGGCAGCGTCCGGG - Intergenic
1061056508 9:128225588-128225610 ATGAGGTCCTGGCCTTGTCCTGG + Intronic
1185445831 X:257702-257724 CGGAGCTCCTTGTATTGTCCAGG + Intergenic
1187609494 X:20926425-20926447 CTAAGGTCCTTACATTATTTGGG + Intergenic
1187754438 X:22506172-22506194 ATAAGGTCCTTCCATTATTCAGG - Intergenic
1187925468 X:24245737-24245759 CTAGAGTCCTTGCATTGTCTGGG - Intergenic
1189109491 X:38273040-38273062 CTAAGGTCCTGGCATTATTTGGG + Intronic
1189629518 X:42937545-42937567 CAAAGGTCCTTGAATTTTCTGGG - Intergenic
1192986990 X:76410215-76410237 CTAAGATCCTTGCAATATCTAGG + Intergenic
1193883074 X:86949924-86949946 CTAAGTTCTTTGCATTGTTTAGG + Intergenic
1194211553 X:91076210-91076232 TTAAAGTCCTTACATTGTCTGGG + Intergenic
1195475204 X:105277540-105277562 CTCAGATCCTTGCTTTCTCCTGG + Intronic
1195726046 X:107917802-107917824 GTAAGGTCTTTGCAATGCCCTGG - Intronic
1195873067 X:109506503-109506525 CTATGGTCCTTGTATTGTTTGGG + Intergenic
1196057090 X:111367603-111367625 CTATAGTCCTTCCTTTGTCCTGG + Intronic
1197955427 X:131941737-131941759 CTAAGGTCCTTATATTGTCCAGG - Intergenic
1199954997 X:152735370-152735392 CTGAGGTCCCTCCATTATCCTGG + Intronic