ID: 1034645836

View in Genome Browser
Species Human (GRCh38)
Location 7:152646500-152646522
Sequence TTTTAGAGATGGAGTCGCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1125
Summary {0: 1, 1: 14, 2: 136, 3: 258, 4: 716}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034645831_1034645836 28 Left 1034645831 7:152646449-152646471 CCATGTCCCTGGCAAAGGTATGA 0: 1
1: 0
2: 1
3: 74
4: 1268
Right 1034645836 7:152646500-152646522 TTTTAGAGATGGAGTCGCCCAGG 0: 1
1: 14
2: 136
3: 258
4: 716
1034645832_1034645836 22 Left 1034645832 7:152646455-152646477 CCCTGGCAAAGGTATGATCTTGT 0: 1
1: 0
2: 0
3: 19
4: 247
Right 1034645836 7:152646500-152646522 TTTTAGAGATGGAGTCGCCCAGG 0: 1
1: 14
2: 136
3: 258
4: 716
1034645833_1034645836 21 Left 1034645833 7:152646456-152646478 CCTGGCAAAGGTATGATCTTGTT 0: 1
1: 0
2: 1
3: 42
4: 424
Right 1034645836 7:152646500-152646522 TTTTAGAGATGGAGTCGCCCAGG 0: 1
1: 14
2: 136
3: 258
4: 716
1034645834_1034645836 -2 Left 1034645834 7:152646479-152646501 CCTTATATTTTATTTTTTATTTT 0: 1
1: 30
2: 251
3: 2827
4: 47980
Right 1034645836 7:152646500-152646522 TTTTAGAGATGGAGTCGCCCAGG 0: 1
1: 14
2: 136
3: 258
4: 716

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034645836 Original CRISPR TTTTAGAGATGGAGTCGCCC AGG Exonic
900203852 1:1422787-1422809 TGTTCAAGATGGAGTCGCTCTGG - Intergenic
901092172 1:6649193-6649215 TTTTTGAGACAGAGTCGCCCAGG + Intronic
901290844 1:8123132-8123154 TATTTAAGATGGAGTCGCTCTGG + Intergenic
901355768 1:8647058-8647080 TTTTTGAGACAGGGTCGCCCAGG - Intronic
901378001 1:8853567-8853589 TTTTTGAGAAGGAGTCTCGCTGG - Intergenic
901410316 1:9078414-9078436 TATTCAAGATGGAGTCGCTCTGG + Intronic
901444517 1:9299773-9299795 TTATAGAGATGATGTCGGCCCGG - Intronic
901457800 1:9373363-9373385 TTTCACAGATGGAGACGCCAAGG - Intergenic
901500076 1:9646927-9646949 TTTTTGAGATGGAGTCTCCCAGG - Intergenic
901519863 1:9775253-9775275 TATTCAAGATGGAGTCGCTCTGG + Intronic
902242375 1:15097521-15097543 TTTTAAAGATGGAGAAGGCCGGG + Intronic
902424531 1:16309370-16309392 TTTAAGAGATGGGGTTGGCCAGG - Intronic
902451645 1:16500101-16500123 TTTTTGAGACGGAGTCACCCAGG + Intergenic
902510344 1:16963482-16963504 TTCTAGAGCTGGAGGCCCCCAGG + Intronic
902860490 1:19241696-19241718 TTGTAGAGATGGGGTTGCCCAGG + Intronic
903051115 1:20601935-20601957 TTGTAGAGATGGGGTTGCCCAGG - Intronic
903139412 1:21330153-21330175 TTTTTGAGACAGAGTCTCCCAGG + Intronic
903366305 1:22807369-22807391 TTTTATAGATGGAGCTGCCAAGG + Intronic
903482645 1:23665478-23665500 TTTTTGAGATGGAGTTGCCCAGG + Intergenic
903601465 1:24544422-24544444 TATTCAAGATGGAGTCACCCTGG + Intergenic
903666834 1:25013222-25013244 TTTTACAGATGAAGACGCCAAGG - Intergenic
903746627 1:25591321-25591343 TTTTTGAGATGGAATCTCCGAGG + Intergenic
903871426 1:26437769-26437791 TTTAAGAGATGGGGTCGGCCGGG - Intronic
903893627 1:26587420-26587442 TTTTCGAGACTCAGTCGCCCAGG - Intergenic
904026527 1:27507312-27507334 TTGTAGAGATGGGGTCTCGCAGG - Intergenic
904123096 1:28216046-28216068 TTTTAGAGATGGGGTCTCCCTGG + Intronic
904123255 1:28217318-28217340 TTTTAGAGATGGGGTCTCCCTGG + Intronic
904123414 1:28218603-28218625 TTTTAGAGATGGGGTCTCCCTGG + Intronic
904177529 1:28641455-28641477 TTTTTGAGACAGAGTCACCCAGG - Intronic
904553334 1:31339980-31340002 TTTTTGAGATGGGGTCGCCCAGG + Intronic
904777803 1:32922108-32922130 TTTTTGAGATGGAGTCTTGCTGG - Intergenic
904961536 1:34337078-34337100 TTGTATAGATGGGGTTGCCCGGG - Intergenic
905055632 1:35091236-35091258 ATTTTGAGACGGAGTCTCCCAGG + Intronic
905079339 1:35303429-35303451 TTTTTGAGACGGAGTCACCCAGG + Intronic
905593795 1:39188244-39188266 TTGTACAGATGGGGTTGCCCAGG - Intronic
906072190 1:43025119-43025141 TTTTAGAGCTGGAGTGGTTCTGG + Intergenic
906811153 1:48828168-48828190 TTTTTGAGATGGAGTTGCCCAGG - Intronic
907195439 1:52682605-52682627 TTTTTGAGATGGTGTCACCCAGG - Intergenic
907281994 1:53354618-53354640 TTTTTGAGATAGGGTCACCCAGG + Intergenic
907306628 1:53516785-53516807 TTTTTGAGATGGAGTCGCCCAGG - Intronic
907414927 1:54307547-54307569 TTTTCAAGATGGAGTTGCTCTGG - Intronic
907542970 1:55233308-55233330 TATTCAAGATGGAGTCGCTCTGG + Intergenic
908367298 1:63438846-63438868 TTTTTGAGATGGTGTCTCACTGG - Intergenic
908471246 1:64446230-64446252 TTTTTGAGACGGAGTCGCCCAGG + Intergenic
908550046 1:65199541-65199563 TTTTTGAGATGGAGTCGCCTGGG - Intronic
909670164 1:78179460-78179482 TTTTTGAGACGGAGTCTCACTGG + Intergenic
909730469 1:78882336-78882358 TTTTTGAGATGGAGTCTCCCAGG - Intergenic
910423994 1:87100740-87100762 TTGTAGAGATGAGGTTGCCCAGG - Intronic
910796205 1:91100048-91100070 TATTTGAGATGGAGTTGCTCTGG + Intergenic
911015261 1:93325543-93325565 TTTTTGAGATGGAGTTGCCCAGG + Intergenic
911043632 1:93610903-93610925 TTTTTGAGACGTAGTTGCCCAGG - Intronic
911112652 1:94207864-94207886 TTTTAGAGACAGAGTCGCACTGG + Intronic
911345657 1:96693893-96693915 TTTTTGAGATGGAGTCACCCAGG + Intergenic
911631803 1:100191989-100192011 TGGTAGAGCTGGGGTCGCCCAGG + Exonic
911953292 1:104204456-104204478 TATTAAAGATGGAGTTGCTCTGG + Intergenic
912087690 1:106030140-106030162 TTTTTGAGATGGGGTCTCACTGG - Intergenic
912326488 1:108768289-108768311 TAGTAGAGATGGGGTTGCCCAGG + Intronic
912766872 1:112421324-112421346 TTTTTGAGACGGAGTTGCCCAGG + Intronic
912818203 1:112847120-112847142 TTTTTGAGACGGAGTCGCCCAGG + Intergenic
912818964 1:112851604-112851626 ATTTTGAGATAGAGTCGCCCAGG - Intergenic
912846964 1:113083233-113083255 TTTTTGATATGGAGTCTCCCAGG + Intronic
912868348 1:113279885-113279907 TTTTAGCTGAGGAGTCGCCCTGG + Intergenic
913134493 1:115874696-115874718 TATTCAAGATGGAGTCGCTCTGG + Intergenic
913243231 1:116848707-116848729 TTTTTGAGATGGAGTTGCCCAGG - Intergenic
913262004 1:117007371-117007393 TTTTTGAGATGGAGTTGCCCGGG + Intronic
913377670 1:118171976-118171998 ATTCAGAGATGGAGACTCCCAGG - Intronic
913666715 1:121055818-121055840 TTTTTGAAACGGAGTTGCCCAGG + Intergenic
914018459 1:143843254-143843276 TTTTTGAAACGGAGTTGCCCAGG + Intergenic
914883619 1:151567090-151567112 TTGTAGAGATGGGGTTGCCCAGG + Intronic
915126974 1:153672566-153672588 TTTTTGAGATGGAGTCTCCCAGG + Intergenic
915327786 1:155089868-155089890 TTTTAAAGATGGGGTCGGCTGGG - Intergenic
915380504 1:155435130-155435152 TTTTTGAGACCGAGTCACCCAGG - Intronic
915475914 1:156152810-156152832 TATTAGAGTTGGATTAGCCCTGG + Intronic
915502781 1:156330886-156330908 TCTTTGAGACAGAGTCGCCCAGG - Intronic
916237422 1:162604239-162604261 TTTTTGAGACGGAGTCGCCCAGG - Intergenic
916524864 1:165600092-165600114 TTTTTGAGACGGAGTCTCGCTGG + Intergenic
917708769 1:177662224-177662246 TTTTAGAGATGAATTCTGCCAGG + Intergenic
918220711 1:182433969-182433991 TTTTTGAGACGGAGTCACCCAGG + Intergenic
918653733 1:186998759-186998781 TTTTGGAGATGGAGTCACCCAGG + Intergenic
919889521 1:201960772-201960794 TTTTTGAGATAGGGTCACCCAGG + Intronic
920134943 1:203762163-203762185 TATTCGAGATGGAGTTGCTCTGG - Intergenic
920357452 1:205385221-205385243 TTTTGGAGACAGAGTCACCCAGG + Intronic
920376579 1:205512026-205512048 TTTTGGAGACGGAGTCACCCAGG - Intronic
921140736 1:212304255-212304277 TTTAAGAGATGGGGTCAGCCAGG + Intronic
921171587 1:212554714-212554736 TTTCTGAGATGGAGTCACCCAGG + Intergenic
921294256 1:213687241-213687263 TATTCAAGATGGAGTCGCTCTGG + Intergenic
922444791 1:225687902-225687924 TTTTTGAGACGGAGTCTCGCTGG - Intergenic
922472487 1:225885082-225885104 TTTTTGAGACGGAGTCGCCCAGG - Intergenic
922787661 1:228291046-228291068 TTGTAGAGATAGGGTCTCCCTGG - Intronic
922829597 1:228545141-228545163 TTTTAGTGATAGAGTCACCTAGG - Intergenic
922922333 1:229316928-229316950 TTTTTGAGACAGAGTCGCCCAGG + Intergenic
922923812 1:229330817-229330839 TTTTTTAGATGGAGTTGCCCAGG - Intronic
923035534 1:230282620-230282642 TTTTTGAGACGGAGTCACCTAGG + Intergenic
923169943 1:231406148-231406170 TTTTTGAGACGGAGTCTCTCTGG - Intronic
923395609 1:233559364-233559386 TTCTAGAGATGGGGTCTCACTGG + Intergenic
923413745 1:233734593-233734615 TATTCAAGATGGAGTCGCTCTGG - Intergenic
923605471 1:235439194-235439216 TTTAAGAGATGGAGTTGGCCGGG + Intronic
923631510 1:235651663-235651685 TTTTAGAGATGCAGACTCCCAGG + Intergenic
924050480 1:240075401-240075423 TGTTAAAGATGGAGTCACTCTGG + Intronic
924151646 1:241135796-241135818 TTTTTGAGACAGAGTTGCCCAGG + Intronic
924727114 1:246681351-246681373 TTTTTGAGACGGGGTTGCCCAGG + Intergenic
924729330 1:246697390-246697412 TTTAAGAGATGAGGTCGGCCGGG + Intergenic
1063266265 10:4454409-4454431 TATTCAAGATGGAGTCGCTCTGG + Intergenic
1063290039 10:4735801-4735823 TTTTTGAGATGGAGTCTCGCTGG + Intergenic
1063341578 10:5270397-5270419 TTTATGAGAAGGAGTCGTCCAGG + Intergenic
1063404444 10:5779480-5779502 TTTTCGAGACGGAGTCACCCAGG - Intronic
1063596492 10:7440473-7440495 TTTTAGAGATAGGGTCACCCAGG - Intergenic
1063705049 10:8422513-8422535 TTTTTTAGATGGAGTCCACCCGG + Intergenic
1063980880 10:11450966-11450988 TTTTTGAGATGGAGTCTTGCTGG + Intergenic
1064171400 10:13036803-13036825 TTTTTGAGATGGGGTCACCCAGG + Intronic
1064350720 10:14573715-14573737 ATTTTGAGATGGAGTTGCCCAGG - Intronic
1064606388 10:17045373-17045395 TTTTTGAGATGGAGTCTCACTGG + Intronic
1064737114 10:18393181-18393203 TTTTTGACATGGAGTCATCCAGG - Intronic
1064788402 10:18925862-18925884 TTATAGAGATGGGGTTGCTCAGG - Intergenic
1064855647 10:19765091-19765113 TTGTAGAGATGGGGTCTCACTGG + Intronic
1064858203 10:19795575-19795597 TTGTAGAGATGGGATTGCCCAGG - Intergenic
1065352706 10:24809893-24809915 TTTTTGAGACAGGGTCGCCCAGG + Intergenic
1065841864 10:29708593-29708615 TTTTTGAGACGGAGTTGCCCAGG - Intronic
1065889249 10:30107138-30107160 TATTCAAGATGGAGTCGCTCTGG - Intronic
1066378394 10:34880278-34880300 TTTTAGAGACAGGGTCACCCAGG + Intergenic
1066389286 10:34965761-34965783 TTTTTGAGACGGAGTGGCCCAGG + Intergenic
1066689797 10:38014897-38014919 TTTTTGAGACAGAGTCGCCCAGG + Intronic
1067002910 10:42634379-42634401 TTTTTGAGACAGAGTTGCCCAGG - Intronic
1067103889 10:43351990-43352012 TTTAAGAGAGGGAGTCGGCTGGG + Intergenic
1069015693 10:63426643-63426665 TTTTTGAGACGGAGTCTCCCAGG - Intronic
1069384017 10:67867800-67867822 TTTTTGAGACGGAGTCTCGCTGG - Intergenic
1069439402 10:68413965-68413987 TTTTTGAGACGGAGTCGCCCAGG - Intergenic
1069485583 10:68820793-68820815 TTTTTGAGACGGAGTCTCACCGG + Intergenic
1069727548 10:70590782-70590804 TATTCAAGATGGAGTCGCTCTGG + Intergenic
1069797761 10:71064070-71064092 TTGTAGAGATGGGGTTACCCAGG - Intergenic
1070074750 10:73123946-73123968 TTTTAGAGATGGGGTCTCACTGG + Intronic
1070198312 10:74179312-74179334 TATTCAAGATGGAGTCGCTCTGG - Intronic
1070516992 10:77217277-77217299 TTTTTGAGACAGAGTCACCCAGG - Intronic
1070614913 10:77962256-77962278 TTGTAGAGATGGGGTCTCCTTGG + Intergenic
1070618911 10:77991536-77991558 TTTTTGAGATGGAGTCTTGCTGG + Intronic
1071082255 10:81826307-81826329 TTTTCAAGATGGAGTTGCTCTGG + Intergenic
1071180465 10:82977581-82977603 TTTTTGAGACAGAGTCACCCAGG - Intronic
1071224738 10:83515730-83515752 TTTTTGAGGTGGAGTCACCCAGG + Intergenic
1071503722 10:86220830-86220852 TTTTAGAGAATGAGTCAGCCAGG + Intronic
1071694745 10:87859998-87860020 TTTTTGAGACGGAGTCTCACAGG - Exonic
1072147047 10:92651050-92651072 TTTTTGAGACTGAGTCACCCAGG + Intronic
1072150900 10:92682190-92682212 TTTTTGAGATGGAGTCTTGCTGG - Intergenic
1072186359 10:93042960-93042982 TTTTTGAGATGGAGTCGCCCAGG + Intronic
1072598576 10:96900892-96900914 TTTAAGAGATGGGGTCGGCCGGG + Intronic
1072993726 10:100224460-100224482 ATTTAGAGACGGAGTCGCCCAGG + Intronic
1073198361 10:101714116-101714138 TTTTAGAGACAGGGTTGCCCAGG + Intergenic
1073340400 10:102739885-102739907 TTTTTGAGACGGAGTCGCCCAGG - Exonic
1073508916 10:104030263-104030285 TTTTTGAGATGGAGTCTTGCCGG + Intergenic
1074308604 10:112301758-112301780 TTTTTGAGACCGTGTCGCCCAGG + Intronic
1074614224 10:115050560-115050582 TATTCAAGATGGAGTCGCTCTGG - Intergenic
1074770792 10:116732302-116732324 TTTTTGAGACGGAGTCACCCAGG - Intronic
1074824225 10:117202904-117202926 TTTTTGAGATGGAGTCTTGCTGG + Intronic
1075002222 10:118807258-118807280 TTGTAGAGACGGGGTTGCCCAGG + Intergenic
1075436934 10:122451528-122451550 TCTTTGAGATGGAGTCGCCCAGG + Intergenic
1075537296 10:123282003-123282025 TATTAGAAATGAAGTGGCCCAGG - Intergenic
1075832352 10:125422213-125422235 TTTTTGAGACGGAGTCACCCAGG + Intergenic
1075866697 10:125728174-125728196 TTTTTGAGACAGAGTTGCCCAGG - Intronic
1075868026 10:125744363-125744385 TTTTAGAGATGAAGTCTTGCTGG + Intronic
1076737656 10:132465976-132465998 TTTTACAGATGGGGAAGCCCAGG + Intergenic
1077201653 11:1310283-1310305 TGTTCGAGCTGGAGTCGCTCTGG - Intergenic
1077313324 11:1903171-1903193 TGTTCAAGATGGAGTCGCTCTGG + Intergenic
1077483750 11:2829178-2829200 TTTTGGTGTTGGAGTCTCCCTGG - Intronic
1077538916 11:3137506-3137528 TTTTAAAGATGCAGTGGGCCGGG + Intronic
1077636646 11:3846348-3846370 TTTTTGAGACAGAGTCACCCAGG + Intergenic
1077640076 11:3873456-3873478 TTGTGGAGATGGATTTGCCCAGG + Intronic
1078412021 11:11131745-11131767 TTTTTGAGAAGGAGTCACCCAGG + Intergenic
1079193373 11:18301437-18301459 TTTTTGAGACAGAGTCACCCAGG - Intronic
1079607226 11:22385301-22385323 TTTTTGAAATGGAGTCACCCAGG + Intergenic
1080005642 11:27403277-27403299 TTGTAGAGATGGGGTTGCCCTGG - Intronic
1080007784 11:27428161-27428183 TTTTTGAGATGCAGTCACCCAGG + Intronic
1080010674 11:27455862-27455884 TTTTAGAGATGGAGAAACCATGG - Intronic
1080400496 11:31930981-31931003 TATTAGATATTGAGTAGCCCAGG + Intronic
1080445979 11:32337574-32337596 TTTAAGACATGGTGTCACCCAGG + Intergenic
1080497774 11:32837581-32837603 ATCTGGAGACGGAGTCGCCCAGG + Intronic
1080624729 11:34017838-34017860 TTTTTGAGACGGAGTCACCCAGG - Intergenic
1081144933 11:39551130-39551152 TTTTTGAGATGGAGTTGCCCAGG - Intergenic
1081379584 11:42398385-42398407 TTGTAGAGATGAAGTTGCCCAGG - Intergenic
1081530169 11:43953079-43953101 TGTTCAAGATGGAGTCGCTCTGG - Intergenic
1083028369 11:59569979-59570001 TTTTAGAGATAGGGTCTCACTGG - Intergenic
1083444324 11:62697367-62697389 TTTTTGAGACGGAGTTGCCCAGG - Intronic
1083453114 11:62759866-62759888 TTTTTGAGAGGGAGTCAGCCGGG + Intergenic
1083483532 11:62966084-62966106 TATTAAAGATGGAGTTGCTCTGG + Intronic
1083808728 11:65090340-65090362 TTTTAGAGATGGGGTCTTGCTGG - Intronic
1084052841 11:66612082-66612104 TTTGAGACATGGGGTCTCCCTGG + Intergenic
1085104542 11:73830867-73830889 TTTTTGAGATGGAGTCTTCCTGG + Intronic
1085490445 11:76911589-76911611 TATTCAAGATGGAGTTGCCCTGG + Intronic
1085707468 11:78799696-78799718 TTTTAGAGATTCAGTGGCACAGG - Intronic
1086084051 11:82936959-82936981 TTTTTGAGACAGGGTCGCCCAGG - Intronic
1086084324 11:82939292-82939314 TTTTGGAGATGGGGTTGACCAGG - Intronic
1086404450 11:86487994-86488016 TTGTAGAGATGGGGTCTCACTGG - Intronic
1086477505 11:87193087-87193109 TTTTTGAGATGGAGTCACCCAGG - Intronic
1087342289 11:96921932-96921954 TTTTAGACAGGGTCTCGCCCAGG - Intergenic
1087388536 11:97504885-97504907 TTTTTGAGACAGAGTCTCCCAGG - Intergenic
1087818057 11:102680659-102680681 ATTTTGAGATGGAGTCGCCCAGG + Intergenic
1088523984 11:110732019-110732041 TTTTTGAGATGGAGTCACCGAGG + Intergenic
1089112604 11:116068639-116068661 TTTTTGAGACAGAGTCGCCCAGG - Intergenic
1089469746 11:118711080-118711102 GTTTGGAGATGGAGTCGCCCAGG + Intergenic
1089486954 11:118853921-118853943 TATTCAAGATGGAGTCGCTCTGG + Intergenic
1089848205 11:121475063-121475085 TTTTAGAGATGGGGTTTCCTAGG - Intronic
1089980293 11:122766531-122766553 TTTTTGAGACGGAGTCTCGCTGG - Intronic
1090037425 11:123260996-123261018 TATTCAAGATGGAGTCGCTCTGG + Intergenic
1090525452 11:127529569-127529591 TTTTTGAGATGGAGTCTCGCTGG - Intergenic
1090582094 11:128171457-128171479 TTTTTGAGACGGAGTCTCGCTGG - Intergenic
1090764267 11:129863331-129863353 TTTTTGAGATGGAGTCTTGCAGG + Intergenic
1091951170 12:4594247-4594269 TTTTTGAGATGGAGTTGCCCAGG + Intronic
1092371701 12:7921999-7922021 AAATAGAGATGGAGTTGCCCAGG - Intronic
1092606189 12:10122501-10122523 TTTTTGAGTTGGAGTCTCACTGG + Intronic
1092612239 12:10184850-10184872 TTTTTGAGATGGCGTCACCACGG + Intronic
1092831080 12:12445048-12445070 TTTTAGAGACAGGGTCTCCCTGG + Intronic
1093143482 12:15537334-15537356 TCTTAAAGTTGGAGTGGCCCAGG - Intronic
1093447048 12:19272554-19272576 TTTTAGAGACGGGGTCTCACTGG - Intronic
1094100021 12:26752259-26752281 TTTTCAAGATGGAGTTGCTCTGG - Intronic
1094572093 12:31650072-31650094 TATTCGAGATGGAGTTGCTCTGG - Intronic
1094594455 12:31852031-31852053 TTTTCAAGATGGAGTTGCTCTGG - Intergenic
1095110576 12:38290599-38290621 TTTTTGAGACTGAGTCGCCCAGG - Intergenic
1095517284 12:43020767-43020789 CTTTCCAGATGGAGTTGCCCTGG + Intergenic
1095541574 12:43314746-43314768 TTTTAGAGACAGAGTATCCCAGG + Intergenic
1095699890 12:45180349-45180371 TTTTTGAGATGGAGTCTTGCTGG + Intergenic
1096290952 12:50342951-50342973 TTTTAAAGATGGAGTCAGGCTGG + Intronic
1097238628 12:57557717-57557739 TTTTTGAGATGGAGTCAGGCTGG + Intronic
1097387105 12:58963098-58963120 TTTTTGAGATGGAGTCACCCAGG + Intergenic
1097837079 12:64283921-64283943 TTTTTGAGATGGGGTTGCCCAGG + Intronic
1097889340 12:64761358-64761380 TTTTCAAGATGGAGTTGCTCTGG - Intergenic
1097964228 12:65562017-65562039 TATTCAAGATGGAGTCGCTCTGG - Intergenic
1098987813 12:77031195-77031217 TTTTAGAGACAGGGTCACCCAGG - Intronic
1099439131 12:82680636-82680658 TTTTTGAGATGGAGTCTCCCAGG + Intergenic
1099574876 12:84365653-84365675 TTTTTGAGACAGAGTTGCCCAGG + Intergenic
1100044647 12:90364838-90364860 TTTTTGAGAGGGAGTCTGCCCGG + Intergenic
1100187792 12:92156472-92156494 TTTCACAGATAGAGTCCCCCAGG - Intergenic
1100305769 12:93348638-93348660 TTTTTGAGACAGAGTTGCCCAGG - Intergenic
1100378496 12:94039982-94040004 TTTTATAGATGGAGAAGCCAAGG - Intergenic
1100448671 12:94684615-94684637 TATTCAAGATGGAGTCGCTCTGG - Intergenic
1100616901 12:96237775-96237797 TTTTAGAGATGGGGTCTTGCTGG - Intronic
1100659166 12:96678274-96678296 TTTCTGAGACGGAGTCACCCAGG + Intronic
1100825204 12:98468396-98468418 TTTTAGAGCTGGAGTCCAGCTGG - Intergenic
1100953939 12:99885324-99885346 TTTTTGAGACAGAGTCACCCAGG + Intronic
1101150967 12:101882132-101882154 TTTTTGAGACGGAGTTTCCCAGG + Intronic
1101509759 12:105382071-105382093 TTTTTGAGACAGGGTCGCCCAGG - Intronic
1102054286 12:109884481-109884503 TTTAAGAGATGGATTCGGCCGGG - Intergenic
1102283042 12:111633523-111633545 TTTTTGAGACGGAGTCTCCTAGG - Intergenic
1102349444 12:112181486-112181508 TTTTAAAGATGGGGTCACCCAGG + Intronic
1102367853 12:112354994-112355016 TTTTTGAGATGGAGTCTTGCTGG + Intronic
1102669966 12:114609851-114609873 TTGTAGAGATGGGATCTCCCTGG + Intergenic
1102768631 12:115453739-115453761 TCTTTGAGATGGAGTTGCCCAGG + Intergenic
1103281900 12:119765217-119765239 TTGTAGAGATGGGGTCTCCCGGG - Intronic
1103380966 12:120494300-120494322 TTTTTGAGACGGAGTTGCCCAGG + Intronic
1103436815 12:120933106-120933128 TTTTAGAGCTGGGGTTGACCGGG + Intergenic
1103452882 12:121041867-121041889 TTTTTGAGACGGAGTCTCGCTGG - Intergenic
1103662383 12:122531387-122531409 TAGTAGAGATGGGGTTGCCCAGG + Intronic
1103957384 12:124585037-124585059 TTGTAGAGATAGTGTTGCCCAGG + Intergenic
1104194377 12:126518980-126519002 TTTTAGAGACGTGGTCACCCAGG + Intergenic
1104197549 12:126555412-126555434 TGTTCAAGATGGAGTCGCTCTGG + Intergenic
1104307594 12:127623527-127623549 TGTTCAAGATGGAGTCGCTCTGG - Intergenic
1104345535 12:127993409-127993431 TTTTTGAGATGGAGTCACCCAGG + Intergenic
1104704732 12:130934507-130934529 TTTTTGAGATGGAGTCTCGCTGG + Intergenic
1105334717 13:19456297-19456319 TTGTAGAGAAGGAGTCTCTCTGG - Intronic
1105525962 13:21177958-21177980 TTTTTGAGATGCAGTCTCCCAGG - Exonic
1105860202 13:24403031-24403053 TTGTAGAGAAGGAGTCTCTCTGG + Intergenic
1105866076 13:24460856-24460878 TTGTACAGATGGGGTTGCCCAGG + Intronic
1106041261 13:26096129-26096151 TATTCAAGATGGAGTCGCTCTGG - Intergenic
1106244385 13:27935904-27935926 TTTTTGAGATGGAGTTGCCCAGG - Intergenic
1106280520 13:28264506-28264528 TTTTGGAGACAGAGTCTCCCAGG - Intronic
1106765789 13:32913107-32913129 TGGTAGAGATGGGGTTGCCCAGG + Intergenic
1107488816 13:40859870-40859892 TTTTAGAGAAGGAGTCTCACTGG - Intergenic
1107488967 13:40861517-40861539 TTGTAGAGAAGGAGTCTCACTGG - Intergenic
1108671137 13:52689941-52689963 TTTTTGAGATGGAGTCGCCCAGG - Intronic
1108901976 13:55422382-55422404 TTTTTGAGACGGAGTCACGCTGG - Intergenic
1109080445 13:57893240-57893262 TTTTCCAGACGGAGTCACCCAGG + Intergenic
1109183801 13:59246005-59246027 TTTTTGAAATGGAGTCTCGCTGG - Intergenic
1110885063 13:80622755-80622777 TTTTTGAGACGGAGTCTCGCTGG + Intergenic
1111663172 13:91236098-91236120 TTTTTGAGATGGAGTCTTACTGG - Intergenic
1112278888 13:98045428-98045450 TTTTTGAGATGGAGTTGCCCAGG + Intergenic
1112479814 13:99764860-99764882 TTTTAAAGATGGGGTCTCACAGG + Intronic
1113519022 13:110925173-110925195 TATTCAAGATGGAGTTGCCCTGG - Intergenic
1113796107 13:113059529-113059551 TTTTGGTGATGGGGTCTCCCTGG + Intronic
1113826414 13:113258031-113258053 TTTTTGAGACAGTGTCGCCCAGG + Intronic
1113840721 13:113359398-113359420 TTGTAGAGATGGAGTCTCCTGGG - Intronic
1113862659 13:113499419-113499441 TATTCAAGATGGAGTCGCTCTGG + Intronic
1114203864 14:20549459-20549481 TTTTTGAGACGGAGTTGCCCAGG + Intergenic
1114561454 14:23594469-23594491 TTTTTGAGACAGAGTCACCCAGG - Intergenic
1116309389 14:43303591-43303613 TTTTACAGATGGAGTAGCTGAGG - Intergenic
1116350522 14:43856679-43856701 TTTAAGAGATGGTGTGGGCCGGG + Intergenic
1116463652 14:45207623-45207645 TTTGTGAGATGGAGTTGCTCAGG - Intronic
1116828655 14:49696195-49696217 TTTTTGAGACAGAGTTGCCCAGG + Intronic
1116884455 14:50205892-50205914 TTTTTGAGATGGAGTTGCCCAGG - Intronic
1117305974 14:54473372-54473394 TTTTTGAGACGGAGTCTCGCTGG + Intergenic
1117362620 14:54992180-54992202 TTTTTGAGACGGAGTCTCCCGGG - Intronic
1118006515 14:61568636-61568658 GTTTAGAGTTGGAGTCAGCCCGG - Intronic
1118113419 14:62748515-62748537 TATTCAAGATGGAGTCGCTCTGG + Intronic
1118209765 14:63754371-63754393 TGTTTGAAACGGAGTCGCCCAGG - Intergenic
1118525018 14:66630495-66630517 TTTTTAAGATGGAGTCGCCCAGG + Intronic
1118769669 14:68933788-68933810 CTGTAGAGATGAAGTTGCCCAGG - Intronic
1118834422 14:69466727-69466749 TTTTAGAGACAGGGTCGCCCAGG + Intergenic
1119510972 14:75210942-75210964 TTTTAGAAATGCAGACGCTCAGG - Intergenic
1120436066 14:84484387-84484409 TATTCAAGATGGAGTCGCTCTGG - Intergenic
1120884011 14:89437490-89437512 TATTCAAGATGGAGTTGCCCTGG - Intronic
1120977219 14:90259645-90259667 TTATTGAGACGGAGTCACCCAGG + Intronic
1121082209 14:91117414-91117436 TGTTCGAGATGGAGTGGCTCTGG + Intronic
1121205497 14:92162927-92162949 TTTTTGAGACAGAGTCACCCAGG + Exonic
1121315110 14:92956663-92956685 TTTTAGAGATGGAGTGACCTGGG + Intronic
1121636854 14:95459749-95459771 TTTTAGAAATGGGGAAGCCCAGG + Intronic
1122385498 14:101343016-101343038 TTTTTGAGACAGAGTCACCCAGG + Intergenic
1122544728 14:102516155-102516177 TTTTTGAGACGGAGTCGCCCAGG + Intergenic
1122677498 14:103427996-103428018 TTTTCAAGATGGAGTTGCTCTGG + Intronic
1123022813 14:105409958-105409980 TTGTAGAGATGGGGTCTCACAGG + Intronic
1123411293 15:20062213-20062235 TTTTTGAGATGGAGTTGCCCAGG - Intergenic
1123520641 15:21069324-21069346 TTTTTGAGATGGAGTTGCCCAGG - Intergenic
1123917494 15:25047508-25047530 TTTTCGAGACAGAGTCGCCCAGG + Intergenic
1124211140 15:27766024-27766046 TATTTAAGATGGAGTCGCTCTGG + Intronic
1124901778 15:33830018-33830040 TTCTTGAGATGGAGTCTTCCTGG + Intronic
1125048340 15:35269489-35269511 TTTTTGAGACGGAGTCACCCAGG + Intronic
1125440286 15:39694772-39694794 TTTTTGAGACGGAGTCTCACTGG - Intronic
1125538772 15:40457981-40458003 TTTGAGAGACGGAGTCTCGCTGG - Intronic
1125780141 15:42258441-42258463 TTTTTGAGATGGAATCTCACTGG + Intronic
1125798468 15:42423065-42423087 TTTAAGAGATGGGGTCTCACAGG + Intronic
1125868093 15:43073133-43073155 TTTTTGAGACAGAGTCGCCCAGG - Intronic
1126021966 15:44410413-44410435 TTTTTGAGACGGAGTCTCACTGG - Intronic
1126028734 15:44474828-44474850 CTTTTGAGATGGAGTCACCCAGG - Intronic
1126646092 15:50876136-50876158 TTTTTGAGACGGTGTCGCCCAGG - Intergenic
1127083220 15:55400537-55400559 TTTTTGAGATGGAGTTTCACTGG - Intronic
1127725207 15:61743182-61743204 TTGTAGAGATTGGGTTGCCCAGG + Intergenic
1128086126 15:64888021-64888043 TTGCAGAGATGGGGTTGCCCAGG - Intronic
1128101455 15:65003828-65003850 TTTTTGAGATGGAGTTGCCCAGG - Intronic
1128194746 15:65742463-65742485 TTTTTGAGATAGAGTCGCAATGG + Intronic
1128342000 15:66828995-66829017 TATTCAAGATGGAGTCGCTCTGG - Intergenic
1128577297 15:68784785-68784807 TTTTCCAGATGGAGACGCCGAGG - Intronic
1128654995 15:69454052-69454074 TTCTTGAGACGGAGTCACCCAGG + Intronic
1129445665 15:75616158-75616180 CTTTAGAGATGGGGTCTCTCCGG + Intronic
1129551308 15:76452854-76452876 TTTTAGAGATAGAGTTGCCCGGG + Intronic
1130235102 15:82126070-82126092 TTAAAGAGATTGAGTTGCCCTGG + Intergenic
1130446557 15:84007539-84007561 TTTTAGTGATGGGGTCTCACTGG - Intronic
1130514328 15:84614643-84614665 TTCCTGAGATAGAGTCGCCCAGG + Intronic
1130544094 15:84842052-84842074 TTTTTGAGATGGAGTTGCCCAGG + Intronic
1130647534 15:85742017-85742039 TTTTTGAGACGGAGTTGCTCAGG - Intronic
1130877262 15:88025444-88025466 ATTTAGAAATGGAGTCACCGTGG + Intronic
1130968079 15:88711737-88711759 TTTTACAGATGAAGTCGCAGAGG - Intergenic
1131025944 15:89141605-89141627 TTTTTGAGACAGAGTTGCCCAGG - Intronic
1131319199 15:91369806-91369828 TTTAAGAGATGGAGTCACCCAGG - Intergenic
1131564511 15:93473495-93473517 TGTTCAAGATGGAGTCGCTCTGG + Intergenic
1131620530 15:94063408-94063430 GTTTTGAGATGGAGTCGGCCAGG - Intergenic
1131835308 15:96384309-96384331 TTGTAGAGATGAGGTCACCCTGG + Intergenic
1132253007 15:100348832-100348854 TGTTCAAGATGGAGTCGCTCTGG + Intergenic
1132377651 15:101340959-101340981 TTTTTGAGACAGAGTCACCCAGG + Intronic
1132470010 16:97268-97290 TTTTGGAAACAGAGTCGCCCAGG + Intronic
1132742846 16:1424104-1424126 TTTTTGAGATGGAGTTGCCCAGG - Intergenic
1132822085 16:1878939-1878961 TTGTAGAGATGGGGTCTCACTGG - Intronic
1133016657 16:2945615-2945637 TTTTTGAGATGTAGTCTTCCAGG - Intronic
1133059122 16:3163137-3163159 TTTTTGAGACGGAGTTGCCCAGG + Intergenic
1133382055 16:5339496-5339518 TTTTTGAGATGGAGTCTTGCTGG + Intergenic
1133546808 16:6815418-6815440 TTTTCAAGATGGAGTCACTCTGG + Intronic
1133664747 16:7955515-7955537 TTTTGGAGATGGAGTCGCCCAGG - Intergenic
1133835380 16:9362998-9363020 ATTTAGAGATGAAGTCACCCAGG + Intergenic
1134123842 16:11602927-11602949 TTGTAGAGATGGGGTCTCGCTGG - Intronic
1134790158 16:16982467-16982489 TATTCAAGATGGAGTCGCTCAGG + Intergenic
1135052292 16:19202907-19202929 TTGTAGAGATGGGGTTGCCCAGG + Intronic
1135117235 16:19734163-19734185 ATGTAGAGATGGGGTCTCCCTGG - Intronic
1135119261 16:19751299-19751321 TTGTAGAGATGGGGTTGCCCAGG - Intronic
1135137193 16:19893820-19893842 TTTTTGAGATGGACTCTCACTGG + Intergenic
1135352008 16:21737235-21737257 TTTTTGAGATGGAGTCTTGCTGG + Intronic
1135391315 16:22095741-22095763 TTATAGAGATGGGGTCTCGCTGG + Intronic
1135393394 16:22112535-22112557 TTGTAGAGATGGGGTCTCACTGG - Intronic
1135450498 16:22553358-22553380 TTTTTGAGATGGAGTCTTGCTGG + Intergenic
1135578256 16:23602841-23602863 TTTTTGAGATGGAGCCTCACTGG - Intergenic
1135662509 16:24308661-24308683 TTGTAGAGATGGAGTTGCCCAGG - Intronic
1135749406 16:25044887-25044909 TTTTTGAGATGGAGTCTCACTGG + Intergenic
1135957662 16:26969761-26969783 TATTTAAGATGGAGTCGCTCTGG - Intergenic
1136252187 16:29012594-29012616 TTTTTGAGATGGAGTCTGTCTGG + Intergenic
1136526920 16:30837087-30837109 TTAAAGAGATGGAGTCGGCCGGG - Intronic
1136611553 16:31369387-31369409 TTTGAAAGTTGGAGTCGTCCGGG - Intronic
1136931036 16:34418168-34418190 TTTTAGAAATGGGGTCAGCCAGG + Intergenic
1136973537 16:34993640-34993662 TTTTAGAAATGGGGTCAGCCAGG - Intergenic
1137261443 16:46833126-46833148 TTTTTGAGATGGAATCTCCTGGG - Intergenic
1137275816 16:46932793-46932815 TTTAAGAGACTGAGTCGGCCGGG - Intergenic
1137695342 16:50458082-50458104 TATTCAAGATGGAGTCGCTCTGG - Intergenic
1137728461 16:50672838-50672860 TTTTGGAGATGAAGTGGCCCTGG + Exonic
1137745310 16:50816162-50816184 TATTCAAGATGGAGTCGCTCTGG + Intergenic
1137948807 16:52761972-52761994 CTTTTGAGAAGGAGTTGCCCAGG - Intergenic
1138010954 16:53379742-53379764 TTTTTGAGACGGAGTCTCGCTGG + Intergenic
1138247468 16:55478516-55478538 TGTTCAAGATGGAGTCGCTCTGG + Intronic
1138478583 16:57286513-57286535 TTTTTGAGATGGAGTCTTGCTGG + Intergenic
1138632839 16:58312703-58312725 TATTAAAGATGGAGTAGCTCTGG + Intronic
1138669118 16:58598615-58598637 TATTTGAGACAGAGTCGCCCAGG - Intronic
1139418972 16:66836743-66836765 TTTAAGAGATGGGGTCGGCCGGG - Intronic
1139509782 16:67420747-67420769 TTTTTGAGACGGAGTCACCCAGG + Intergenic
1139790018 16:69426381-69426403 TTTTTGAGATGGAATCTCGCTGG - Intronic
1140023643 16:71263442-71263464 TATTCAAGATGGAGTCGCTCTGG - Intergenic
1140375180 16:74439710-74439732 TTTTTGAGACAGAGTCACCCGGG - Intergenic
1140666626 16:77233975-77233997 TATTCAAGATGGAGTCGCTCTGG - Intergenic
1140772278 16:78215898-78215920 TTTTTGAGATGGAATCACCCAGG - Intronic
1141180237 16:81747898-81747920 TTTTTGAGATGGAATCACCCAGG + Intronic
1141555028 16:84831426-84831448 CTTTTGAGATAGAGTCGCCCAGG + Intronic
1141666263 16:85467032-85467054 TTTTTAAGATGGAGTCGCCCAGG - Intergenic
1142185472 16:88692829-88692851 CTTTTGAGAAGGAGTCTCCCAGG - Intergenic
1142320020 16:89375749-89375771 TTTAAGAGACGGAGTCGGCTGGG - Intronic
1143221734 17:5267599-5267621 TTTTTGAGACGGAGTCGCCCAGG - Intergenic
1143227781 17:5321864-5321886 TTTTAGAGACAGGGTTGCCCAGG - Intronic
1143243163 17:5461315-5461337 TTTTTGAGATGGAGTTTCACCGG + Intronic
1143276697 17:5716878-5716900 TTTTTGAGATGGAGTTGCCCAGG + Intergenic
1143399281 17:6631906-6631928 TTTATGAGACGGAGTCACCCAGG + Intronic
1143407836 17:6689749-6689771 TTTTATACATGCAGACGCCCAGG + Intronic
1143467223 17:7145550-7145572 TTTTTGAGACGAAGTCGCCCAGG - Intergenic
1143494337 17:7303081-7303103 TTTTTGAGACAGAGTCGCCCAGG + Intergenic
1143710267 17:8729537-8729559 TTTTTGAGATGGAGTTGCCCAGG - Intergenic
1144392086 17:14803207-14803229 TTTTAGAGATTGTGTCACCCAGG + Intergenic
1144472906 17:15560579-15560601 GTTTTGAGACGGAGTCGCCCAGG + Intronic
1144885383 17:18455034-18455056 TTTAAGAGACGGAGTTGGCCGGG + Intergenic
1144963135 17:19058049-19058071 TTTTTGAGACAGAGTCTCCCAGG + Intergenic
1144968959 17:19095133-19095155 TTGTAGAGATGGGGTCTCACTGG + Intronic
1144972024 17:19116476-19116498 TTTTTGAGACAGAGTCTCCCAGG - Intergenic
1144978957 17:19156933-19156955 TTGTAGAGATGGGGTCTCACTGG - Intronic
1144989265 17:19221299-19221321 TTGTAGAGATGGGGTCTCACTGG + Intronic
1145045410 17:19611121-19611143 TTTTTGAGACGGAGTCACCCAGG + Intergenic
1145320592 17:21765008-21765030 TTTTCGAGACGGAGTCTCGCTGG + Intergenic
1145325372 17:21818270-21818292 TTTTAGAAGTGGAGCCACCCGGG - Intergenic
1145745029 17:27311655-27311677 TTTTTGAGATGTAGTCTCCCAGG + Intronic
1146585849 17:34080858-34080880 TTTTAGTGATGGAGTGGGTCTGG + Intronic
1146901763 17:36593274-36593296 TCTCAGACATGGAGTCACCCTGG - Intronic
1147267048 17:39240881-39240903 TTTTTGAGACAGAGTCGCCCAGG + Intergenic
1147440837 17:40446291-40446313 TTTACGAAATAGAGTCGCCCAGG - Intronic
1147655654 17:42089132-42089154 TTGTAGAGATGGAGTTGCCCAGG - Intergenic
1147695779 17:42351782-42351804 TTTTTGAGATGGAATCGCCTAGG + Intronic
1147720233 17:42535486-42535508 TGTTCAAGATGGAGTCGCTCTGG + Intergenic
1147788870 17:43000491-43000513 TTTTTGAGACGGAGTCGCCCAGG + Intronic
1147832982 17:43310231-43310253 TTGTAGAGATGGGGTCTCACTGG + Intergenic
1148028788 17:44606064-44606086 TTTTAAAGATGAAGTGGGCCGGG - Intergenic
1148141461 17:45332087-45332109 TTTTTGAGACAGAGTCACCCAGG - Intergenic
1148433461 17:47662273-47662295 TTTTTGAGATGGAGTCTCCCAGG - Intronic
1148626988 17:49077050-49077072 TATTCAAGATGGAGTCGCTCTGG + Intergenic
1149141943 17:53441753-53441775 TTTTTGAGATGGAGTCTCACAGG + Intergenic
1149336008 17:55636861-55636883 CTTTAAAGATGGAGAGGCCCAGG + Intergenic
1149431730 17:56599491-56599513 TTGTAGACATGAAGTTGCCCAGG - Intergenic
1149482107 17:57012061-57012083 TTTTTGAGATAGAGTCACTCAGG + Intergenic
1149585308 17:57782474-57782496 TTTCTGAGATGGAGTCGCCCAGG + Intergenic
1150012841 17:61522551-61522573 TTTTTGAGATGGAGTCTCACTGG + Intergenic
1150125918 17:62634787-62634809 TTTTAAAGATGGAGTTGCTCTGG + Intronic
1150362689 17:64550739-64550761 TTTTGGAGACAGAGTTGCCCAGG - Intronic
1150680219 17:67278535-67278557 TATTCAAGATGGAGTCGCTCTGG - Intergenic
1151149245 17:72069464-72069486 TTTTTGAGATGGAGTCACCCAGG - Intergenic
1151643538 17:75414105-75414127 TTGTAGAGATGGGGTTTCCCAGG + Intergenic
1151736357 17:75943199-75943221 TTTTTGAGATGGAGTCTCCCAGG - Exonic
1151796529 17:76350057-76350079 TTTTTGAGATAAAGTCACCCAGG - Intronic
1151968786 17:77446374-77446396 TTTTTGAGACGGAGTCACCCAGG + Intronic
1152409320 17:80113990-80114012 TTTTTGAGATGGAGTCACACAGG - Intergenic
1152765406 17:82134766-82134788 TTTTTGAGATGGAGTTACCCAGG - Intronic
1152978356 18:246899-246921 TTTTTGAGACGGAGCCTCCCAGG - Intronic
1153252534 18:3136964-3136986 TTTTTGAGACGGAGTCTCGCTGG + Intronic
1153294923 18:3536007-3536029 TTTTTGAGACAGAGTTGCCCAGG - Intronic
1153323074 18:3792453-3792475 TTTTTGAGATGGAGTCTCGCTGG - Intronic
1153670745 18:7409943-7409965 TTTAAGAGACGGAGTTGGCCGGG + Intergenic
1153945394 18:10013169-10013191 TTTTGGAGAGGGAGAGGCCCTGG + Intergenic
1154311511 18:13270337-13270359 TTTAAGAGACAGAGTCACCCAGG - Intronic
1154477534 18:14777913-14777935 TTTTTGAGATGAAGTCTCACAGG - Intronic
1156015225 18:32539613-32539635 TTTTTGAGATGTAGTCACCCAGG - Intergenic
1156461321 18:37322876-37322898 TTTTAGAGATGGAGAGGCTGAGG + Intronic
1156466963 18:37353780-37353802 TTTTTGAGATGGAGTCACCCAGG + Intronic
1156509665 18:37625878-37625900 TTTTTGAGATGGAGTTGCCCAGG + Intergenic
1156695084 18:39755892-39755914 TTTTTGAGATGGAGTCACCCAGG - Intergenic
1157252840 18:46110900-46110922 TTTTTGAGACGGAGTTGCCCAGG + Intronic
1157258940 18:46162196-46162218 TATTCAAGATGGAGTCGCTCTGG + Intergenic
1157371590 18:47117783-47117805 TTTTAGAGATGGAGTCTCTCTGG - Intronic
1157393648 18:47324201-47324223 TTTTAGAGACAGAGTCTCCCAGG - Intergenic
1157792421 18:50544596-50544618 TATTCAAGATGGAGTCGCTCTGG - Intergenic
1158149637 18:54353475-54353497 TTGTAGAGATGGGGTTGCCCAGG - Intronic
1158709757 18:59827151-59827173 TATTCAAGATGGAGTCGCTCTGG - Intergenic
1159077960 18:63702563-63702585 ATTTTGAGATGGAGTCTCACAGG - Intronic
1159546906 18:69851213-69851235 TTTTTGAGATGCAGTCTCCCAGG + Intronic
1159615125 18:70570978-70571000 TGCTAGAGATGGAGTCCCCTTGG - Intergenic
1159723879 18:71929685-71929707 TTTTTGAGACGGAGTCTCTCTGG + Intergenic
1159864782 18:73691268-73691290 TATTCAAGATGGAGACGCCCTGG - Intergenic
1160465872 18:79075334-79075356 TTGTAGAGATGGGGTTGCACTGG + Intronic
1160753333 19:745667-745689 TTTCTGAGATGGAGCTGCCCAGG - Intronic
1161071279 19:2262679-2262701 TTTTTGAGACGGAGTCACCCAGG - Intronic
1161128924 19:2576728-2576750 TTTTACAGATGGGGTCTCCCTGG + Intronic
1161171020 19:2812569-2812591 CTGTAGAGGTGGAGTCCCCCGGG + Intronic
1161190796 19:2954232-2954254 TATTCAAGATGGAGTCGCTCTGG - Intergenic
1161223698 19:3132174-3132196 TTTTAGAAATGGGGTCTCACTGG + Intergenic
1161811060 19:6471658-6471680 TTTTTGAGATGGAGTTGCTCTGG + Intronic
1161940464 19:7399960-7399982 TGTTAGAGATAGGGTTGCCCAGG + Intronic
1162392385 19:10397434-10397456 TTTTTGAGACGGAGTCGCCCAGG + Intronic
1162442744 19:10703086-10703108 TTTTTGAGACAGAGTCGCCCAGG + Intronic
1162701184 19:12516145-12516167 TTTTTGAGATGGAGTCACCCAGG + Intronic
1162976867 19:14211619-14211641 TTTTTGAGACGCAGTTGCCCAGG + Intergenic
1163136583 19:15315828-15315850 TTTTTGAGACAGAGTCACCCAGG - Intronic
1163375822 19:16929672-16929694 TTTTAGAGAGAGAGTCACCCAGG - Intronic
1163523588 19:17806924-17806946 TTCTTGAGATGGAGTTGCCCAGG - Intronic
1163598844 19:18235966-18235988 GTTTTTAGATGGAGTCGCCCAGG + Intronic
1163737201 19:18988721-18988743 TTTTAGATATAGGGTTGCCCAGG + Intergenic
1163795657 19:19336480-19336502 TTCTAGAGATGATCTCGCCCAGG + Intronic
1163801129 19:19366425-19366447 TTTTTGAGATGGAGTTTCGCTGG + Intergenic
1163898986 19:20084077-20084099 TTTTTGAGACGGAGTCTCCCAGG + Intronic
1164204030 19:23043145-23043167 TTTTTGAGATGGAGTTGCTCTGG - Intergenic
1164297651 19:23927671-23927693 TTGTAGGGATAGAGTTGCCCAGG + Intronic
1164314675 19:24076573-24076595 TATTCAAGATGGAGTCGCTCTGG + Intronic
1164560597 19:29289375-29289397 TTTTAGAGACAGGGTTGCCCAGG - Intergenic
1164653894 19:29906603-29906625 TTTTTGAGACGGAGTCGCCCAGG + Intergenic
1164900584 19:31917815-31917837 TATTCGAGATGGAGTTGCTCTGG + Intergenic
1164978537 19:32594140-32594162 TCTTTGAGATGGAATCACCCAGG - Intergenic
1164988227 19:32664765-32664787 TTGTAAAGATGGGGTTGCCCAGG - Intronic
1164989460 19:32673962-32673984 TTGTAGAGATGGAGTCTAGCAGG - Intronic
1165035640 19:33031705-33031727 TGTGTGAGATGGAGTCGCCCAGG + Intronic
1165267671 19:34675426-34675448 TATTCAAGATGGAGTCGCTCTGG - Intronic
1165335286 19:35165672-35165694 TATTCGAGATGGAGTTGCTCTGG + Intronic
1165550217 19:36577504-36577526 TTTTTGAGACAGAGTCACCCAGG + Intronic
1165776598 19:38408234-38408256 TTTTTGAGACAGAGTCGCCTAGG - Intronic
1166232669 19:41434380-41434402 TTTTTGAGATAGGGTCTCCCAGG - Intronic
1166510535 19:43405897-43405919 TTTTTGAGATGGAGTCTTGCTGG - Intronic
1166537076 19:43581043-43581065 TTTTTTAGACGGAGTTGCCCAGG - Exonic
1166708143 19:44920102-44920124 TTTAAGAGATGGAGTCACCCAGG + Intergenic
1166724796 19:45020403-45020425 TTATAGAGACGGGGTTGCCCAGG + Intronic
1166739753 19:45106723-45106745 TTGTAGAGATGGATTTGCACCGG + Intronic
1167395975 19:49229185-49229207 TTTTTGAGATGGAGTCTCTGTGG + Intergenic
1167409085 19:49334459-49334481 TTTTTGAGACAGGGTCGCCCAGG - Intergenic
1167457345 19:49603844-49603866 TTTTTGAGACGGAGTCGCCCAGG + Intronic
1167480822 19:49729941-49729963 TTTTTGAGACAGAGTTGCCCAGG + Intergenic
1167674995 19:50878330-50878352 TCTGAGAGATGGAGTTGCCTAGG + Intronic
1168038769 19:53741229-53741251 TTTTTGAGATGGAGTCGCCCAGG - Intergenic
1168047249 19:53802930-53802952 TTGTAGAGATGAAGTCTCACTGG + Intronic
1168219846 19:54952769-54952791 TATTCAAGATGGAGTTGCCCTGG - Intronic
1168382697 19:55937809-55937831 TTTTCAAGATGGAGTTGCTCTGG - Intergenic
1168525534 19:57085762-57085784 ATTTAGAGACGGAGTCGCCCAGG + Intergenic
1168715384 19:58524046-58524068 TTTTTGAGACAGAGTCTCCCAGG - Intronic
925717266 2:6796032-6796054 TTTGAGAGAGAGAGTCGGCCAGG + Intergenic
926060877 2:9803981-9804003 TTTTTGAGATGGAGTCTTCCAGG + Intergenic
926117508 2:10222735-10222757 TATTCAAGATGGAGTCGCTCTGG - Intergenic
926321989 2:11754989-11755011 TTTTTGAGACGGAGTCACCCAGG + Intronic
926503849 2:13686190-13686212 TTTTTGAGATGGAGTCACCCAGG - Intergenic
926654555 2:15387091-15387113 TTTTTCTGAAGGAGTCGCCCAGG + Intronic
927251401 2:20997863-20997885 TCTTAGAAATGGAGTTGCCTTGG - Intergenic
927574928 2:24192959-24192981 TATTTAAGATGGAGTTGCCCTGG + Intronic
927738533 2:25545645-25545667 TTTTTGAGACAGAGTCACCCAGG + Intronic
927964236 2:27259197-27259219 TTTAAGAGATGGGGTTGGCCGGG + Intronic
927983416 2:27390040-27390062 TTTTTGAGATGGAGTCTCCCAGG + Intronic
928073348 2:28240144-28240166 TTAAAGAGATGAGGTCGCCCAGG + Intronic
928109473 2:28494990-28495012 TTGTAGAGATGGAGTTGCCCAGG + Intronic
928169905 2:28996782-28996804 TTTTTGAGATGGAGTCTCAGTGG - Intronic
928373942 2:30760096-30760118 TTTTTGAGATGGAGTCTTGCTGG + Intronic
928497525 2:31849284-31849306 TTTTTGAGATGGAGTCACCCAGG - Intergenic
928824093 2:35398049-35398071 TTTTTGAGATGGAGTCTCCCAGG + Intergenic
929137221 2:38636749-38636771 TTTTTGAGATAGAGTCTCGCTGG - Intergenic
930797491 2:55408324-55408346 TATTCGAGATGGAGTTGCTCTGG - Intronic
931100307 2:58991817-58991839 TATTCGAGATGGAGTTGCTCTGG + Intergenic
931343739 2:61427051-61427073 TTTTTGACATGGAGTTGCCCAGG + Intronic
931386713 2:61804392-61804414 TTTTCAAGATGGAGTTGCTCTGG + Intergenic
932244324 2:70183709-70183731 TTAAAGAGATGGGGTCGGCCGGG - Intronic
932504655 2:72217017-72217039 TTTTTGATATGGAGTCGCCCAGG - Intronic
932521092 2:72413390-72413412 TTTAAGAGATGGGGTCGGCCAGG + Intronic
932545142 2:72700923-72700945 CTTTTGAGACAGAGTCGCCCAGG - Intronic
932558468 2:72846204-72846226 TTTTTGAGACAGAGTTGCCCAGG - Intergenic
932611175 2:73201390-73201412 TTTCTGAGATGGAGTTGCCCAGG - Intergenic
932652877 2:73579082-73579104 TTTTTGAGACGGAGTCGTCCTGG + Intronic
932783936 2:74582993-74583015 CTTTTGAGATGGAGTTGCCCAGG - Intronic
933065211 2:77783438-77783460 TTGTAGAGATGGGGTTTCCCAGG + Intergenic
933440379 2:82305865-82305887 TTTTTGAGACGGAGTTGCCCAGG + Intergenic
933670217 2:85000149-85000171 TTTTTGAGATGGAGTCACCCAGG + Intronic
933874319 2:86602923-86602945 TTTTTGAGATGGAGTCTCACTGG - Intronic
934074676 2:88417641-88417663 ATTTTGAGATGGAGTTGCCCAGG - Intergenic
934079499 2:88455484-88455506 TTTTTGAGACGGAGTCCCGCTGG - Intergenic
934102121 2:88663262-88663284 TTTTAGAAATGCAGACACCCGGG - Intergenic
934468125 2:94284589-94284611 TTTTTGAGATGGAATCACCCAGG - Intergenic
935105956 2:100044020-100044042 TACTAGAGATGGAGACGCTCAGG - Intronic
935495798 2:103780185-103780207 TTTTAGAGTTGGAATTGCTCAGG + Intergenic
935596823 2:104885305-104885327 TATTCAAGATGGAGTCACCCTGG - Intergenic
935719486 2:105967520-105967542 TTTTACAGATGAAGGAGCCCTGG + Intergenic
936289327 2:111207901-111207923 TTTTAGAGATAGAGTCAAACTGG - Intergenic
936407322 2:112217345-112217367 TTTTTGAGATGGAGTCACCCAGG - Intronic
936706931 2:115086468-115086490 TTTTTGTGACGGAGTCTCCCAGG + Intronic
937562559 2:123243811-123243833 TTTTTGAGACAGAGTCACCCAGG - Intergenic
937917392 2:127105885-127105907 TTTCAGAGTTGGAGTCGTCAGGG + Intronic
938155072 2:128929248-128929270 TTTTTGAGACGGAGTCGCCCCGG - Intergenic
938277176 2:130037272-130037294 CTTTTGAGATGGAGTCTCCTTGG + Intergenic
938339164 2:130523913-130523935 TTTGACAGATGGAGGTGCCCAGG - Intronic
938350673 2:130596837-130596859 TTTGACAGATGGAGGTGCCCAGG + Intronic
938386006 2:130867949-130867971 TTTTGGAGACAGAGTCACCCAGG + Intronic
938438208 2:131300102-131300124 GTTTTGAGATGGAGTCTCCTTGG - Intronic
938781842 2:134591558-134591580 TATTAAAGATGGAGTTGCTCTGG + Intronic
938987045 2:136586927-136586949 TTTTTGAGACAGAGTCACCCAGG + Intergenic
940281993 2:151998297-151998319 TTTTGGAGATGGAGTTGCCCAGG - Intronic
941723838 2:168839867-168839889 TTTTTGAGACGGAGTCTCTCTGG - Intronic
941811380 2:169759083-169759105 TTGTAGAGATAGAGTTGCACAGG - Intronic
941993427 2:171578604-171578626 TATTCAAGATGGAGTCGCTCTGG + Intergenic
942078987 2:172382742-172382764 TTTTTGAGACGGAGTCTCGCTGG - Intergenic
942189157 2:173454172-173454194 TTTTTGAGATGGGGTCTCACTGG + Intergenic
942561341 2:177222761-177222783 TCTTTGAGATGGGGTCACCCAGG - Intronic
942599561 2:177627048-177627070 TTTTTGAGACGGAGTCTCGCTGG + Exonic
942610501 2:177737573-177737595 TTTTTGAGACAGAGTCGCCCAGG - Intronic
944289011 2:197983412-197983434 TTGTAGAGACGGAGTCTCCCTGG + Intronic
944405075 2:199374946-199374968 TTTTTGCGACGGAGTCTCCCTGG - Intronic
944564216 2:200970950-200970972 TTTTTGAGACGGTGTCGCCCAGG - Intergenic
944758060 2:202784417-202784439 TTTTGGAGACAGAGTCGCCCAGG - Intronic
945231846 2:207598820-207598842 TTTTTGAGATGGAGTCGCCCAGG - Exonic
945260384 2:207837647-207837669 TTTTTGAGATGGAGTCAGGCTGG + Intronic
945804886 2:214478451-214478473 TTTTTGAGATGGAGTTGCCCAGG - Intronic
945904019 2:215570526-215570548 TTTTGGAGATGGAGTCTCGCTGG + Intergenic
946462170 2:219878442-219878464 TTTTCAAGATGGAGTTGCTCTGG - Intergenic
947016056 2:225621095-225621117 TTTTTGAGACGGAGTCTCGCTGG - Intronic
947427413 2:229996250-229996272 TTTTTTAGATGGGGTCGCCCAGG - Intronic
949008456 2:241664645-241664667 TTATAGAGAGGGAGTTGTCCAGG - Intronic
1168791825 20:582797-582819 TGGTAGAGATGGAGTTTCCCAGG - Intergenic
1168825834 20:813217-813239 TATTCAAGATGGAGTTGCCCTGG - Intergenic
1169210293 20:3762541-3762563 TTGTAGAGACAGAGTTGCCCAGG + Intronic
1169273699 20:4219211-4219233 TTTTTGAGATGGAGTTGCCCAGG + Intergenic
1169373553 20:5047393-5047415 TTTTTGAGACAGAGTCACCCAGG + Intergenic
1169462540 20:5808248-5808270 TTTTTGAGATGGAGTCTTGCTGG - Intronic
1169545593 20:6647542-6647564 TTTTTGAGATGGAGTCTCCCAGG + Intergenic
1169561536 20:6805885-6805907 TTTTTGAGATGGAGTCTCACTGG - Intergenic
1169565839 20:6852669-6852691 TATTCAAGATGGAGTCGCTCTGG + Intergenic
1170182132 20:13543583-13543605 TTTTTGAGATGGAGTCTCGCTGG - Intronic
1170193484 20:13666840-13666862 CTTTTGAGATGGAGTCACCCAGG - Intergenic
1170638399 20:18129488-18129510 TTTCTGAGATGGAGTCACCCAGG + Intergenic
1170640803 20:18151048-18151070 TTTTTGAGATAGAGTCTCCCAGG + Intronic
1170820011 20:19749529-19749551 TTTTCAAGATGGAGTCGCTCTGG - Intergenic
1171047626 20:21825796-21825818 TTTTTGAGACAGAGTTGCCCAGG + Intergenic
1171171615 20:23020445-23020467 TATTCAAGATGGAGTCGCTCTGG - Intergenic
1172048410 20:32098221-32098243 TAGTAGAGATGGAGTTGGCCAGG + Intronic
1172052844 20:32132376-32132398 TTTTTGAGACGGAGTTACCCAGG - Intronic
1172343638 20:34179384-34179406 TTTTTGAGACGGAGTCACCCAGG + Intergenic
1172382053 20:34502682-34502704 TTTTTGAGGCGGAGTCTCCCAGG - Intronic
1172559872 20:35877262-35877284 TTTTTGAGATGGAGTCTCTCAGG - Intronic
1172572671 20:35982736-35982758 TTTTTGAGACAGAGTCACCCAGG + Intronic
1172727382 20:37056019-37056041 TTTTTGAGACCGAGTTGCCCAGG - Intronic
1173107725 20:40153513-40153535 TTTTTGAGATGGAGTTACCTAGG + Intergenic
1173303116 20:41821509-41821531 TTCTAGAGATGGAATTGCCGAGG + Intergenic
1173394836 20:42669595-42669617 TTTTATAGATGGTGCCGCCAAGG + Intronic
1173437308 20:43044629-43044651 TTTTACAGGTGGAGTGGCACAGG - Intronic
1173532674 20:43782467-43782489 TATTCAAGATGGAGTCGCTCTGG + Intergenic
1173618755 20:44420304-44420326 TTTTTGAGATGGAGTCACCCAGG - Intronic
1174122734 20:48278929-48278951 TATTCAAGATGGAGTCGCTCTGG - Intergenic
1174241614 20:49140159-49140181 TTTTTGAGACGGAGTCTCACTGG - Intronic
1174323810 20:49763104-49763126 TATTCCAGATGGAGTCGCTCTGG + Intergenic
1174330895 20:49816608-49816630 TTTTTGAGATGGAGGCACACTGG - Intronic
1174366528 20:50059939-50059961 TTTTTGAGACAGAGTCGCCCAGG + Intergenic
1174608363 20:51778227-51778249 TGTTCGAGATGGAGTGGCTCTGG - Intergenic
1174802394 20:53575288-53575310 TTGTAGAGATGGAGTTGCCCAGG - Intronic
1174918695 20:54679692-54679714 TTTTTGAGACAGAGTCGCCCAGG + Intergenic
1175043087 20:56074605-56074627 TTTTAGAGATGAAGTCACCCAGG - Intergenic
1175444767 20:59012430-59012452 TATTCAAGATGGAGTCGCTCTGG + Intergenic
1177460324 21:21400609-21400631 TTTTTGAGATGGAGTCGCCCAGG + Intronic
1177756195 21:25350692-25350714 TGTTTTAGATGGAGTTGCCCAGG - Intergenic
1177836755 21:26193210-26193232 TTTTAGAGATGGGCTGGCTCTGG - Intergenic
1178294926 21:31401725-31401747 TTGTAGAGATGGGGTCTCGCTGG - Intronic
1178306666 21:31496442-31496464 TTTTTGAGACAGAGTTGCCCAGG - Intronic
1178460413 21:32797272-32797294 CTTTTGAGATGAAGTCGCCCGGG + Intronic
1178522844 21:33300819-33300841 TCTTCAAGATGGAGTCGCTCTGG - Intergenic
1179405000 21:41118571-41118593 TGTTTGAGACGGAGTCGCCCAGG + Intergenic
1179796064 21:43784424-43784446 TATTCAAGATGGAGTCGCTCTGG + Intergenic
1180555847 22:16572732-16572754 TTCTAGAGATGAAGTAGCCCAGG + Intergenic
1181152977 22:20898466-20898488 TTGTAGAGATGGGGTTGGCCAGG + Intergenic
1181263068 22:21612667-21612689 TTTTTGAGACGGAGTCACCCAGG + Intronic
1181347908 22:22233719-22233741 TTTTGGAGACAGAGTCTCCCAGG - Intergenic
1181641126 22:24199400-24199422 TTTTTGAGATGGAGTTTCGCTGG + Intergenic
1181981756 22:26771933-26771955 TTTTTGAGATGGAGTTGCCCAGG - Intergenic
1182085205 22:27556568-27556590 TTTTAAAGATGAAGTTGCCGAGG + Intergenic
1182258016 22:29051863-29051885 TTTTTGAGATGGAGTCGCTCAGG - Intronic
1182491598 22:30675925-30675947 TATTCAAAATGGAGTCGCCCTGG + Intergenic
1182516691 22:30862945-30862967 TTTTTGAGACAGAGTCACCCGGG - Intronic
1182654888 22:31881918-31881940 CTTTTGAGATGGAGTCGCCCAGG - Intronic
1182837159 22:33351765-33351787 TTTTTGAGACAGAGTCACCCAGG + Intronic
1183000731 22:34856511-34856533 TTTTTGAGACGGAGTCTCGCTGG - Intergenic
1183105843 22:35614471-35614493 TTTTTGAGATGGAGTCTTGCTGG - Intronic
1183154381 22:36063818-36063840 TTTTAAAGATGGAGGTGGCCAGG - Intergenic
1183219261 22:36501868-36501890 TTTAAGAGATGAAGTCGGCCAGG + Intronic
1183857833 22:40647953-40647975 TTTTGGAGATGGAGTCACCAAGG + Intergenic
1183894196 22:40954810-40954832 ATTCTGAGATGGAGTCGCCCAGG + Intronic
1183974736 22:41504903-41504925 TTGTACAGGTGGAGTTGCCCAGG + Intronic
1184182749 22:42842028-42842050 TTTTTGAGACGGAGTTGCCCCGG + Intronic
1184226316 22:43130640-43130662 TTTTTGAGATGGAGTCGGCCGGG + Intergenic
1184539822 22:45113613-45113635 TTTTTGAGACGGAGTCATCCAGG - Intergenic
1185037355 22:48486440-48486462 TTGAAGAGATGGGGTCTCCCTGG - Intergenic
1185296092 22:50055837-50055859 TATTCAAGATGGAGTCGCTCTGG - Intronic
949100947 3:144790-144812 TTTTTGAGATGGAGTTGCCCAGG + Intergenic
949364498 3:3266445-3266467 TATTCAAGATGGAGTCGCTCTGG - Intergenic
949785297 3:7733653-7733675 TATTCAAGATGGAGTTGCCCTGG + Intronic
950283540 3:11726783-11726805 TTTTTGAGACAGAGTCGCCCAGG - Intergenic
950491920 3:13310819-13310841 TTTTTTAGATGGAGTCTCACTGG + Intergenic
951024383 3:17814345-17814367 TTTTTGAGATGGAGTCACCCAGG - Intronic
951084204 3:18491857-18491879 TTTTTGAGATGGAGTTTTCCTGG + Intergenic
951209982 3:19964637-19964659 TGTTTGAGACGGAGTCACCCAGG + Intronic
951222847 3:20086805-20086827 TTTTTGAGATGGAGTCTCGCAGG + Intronic
951256897 3:20460376-20460398 TTTTTGAGACGGAGTCGCCCAGG + Intergenic
951837504 3:26999478-26999500 TTGTAGAGATAGGGTTGCCCAGG - Intergenic
951892425 3:27579714-27579736 TTTTTGAGATGGAGTCTCGCTGG + Intergenic
951917063 3:27812475-27812497 TTTTTGAGACAGAGTTGCCCAGG - Intergenic
952179934 3:30906878-30906900 TATTCAAGATGGAGTCGCTCTGG + Intergenic
952295283 3:32056756-32056778 TTTTCAAGATGGAGTTGCTCTGG - Intronic
952369522 3:32707775-32707797 TTTTTGAGATGGAGTCACCCAGG - Intronic
952381276 3:32807297-32807319 TCTTAGAGATAGGGTCTCCCAGG - Intergenic
953320376 3:41966122-41966144 TATTCGAGATGGAGTCACTCTGG - Intergenic
953320681 3:41968587-41968609 TTTTTGTGATAGAGTCTCCCAGG + Intergenic
953986169 3:47444795-47444817 TTTTTGAGATGGGGTTGCCCAGG + Intronic
954040328 3:47881785-47881807 TTGTAGAGATGGGGTCTCCCTGG + Intronic
954260020 3:49432025-49432047 TTTTTGAGACGGAGTCGCCCAGG - Intergenic
954270808 3:49507157-49507179 TTTTGGAGAAGGAGTTGGCCAGG - Intronic
954303208 3:49712198-49712220 TTTTTGAGATGGAGTCACCCAGG - Intronic
954346695 3:50006074-50006096 TTTTTGAGATGGAGTCTCACTGG + Intronic
954667421 3:52264145-52264167 TTTTTGAGATGGAGGCTCACCGG - Intronic
954738493 3:52727499-52727521 TTTTTGAGATGGAGTCACCCAGG + Intronic
954772916 3:52989405-52989427 TTTTTGAGATGGAGTCAGGCTGG - Intronic
955127502 3:56128040-56128062 TTTTTGAGATGGAGTCTTGCTGG - Intronic
955297088 3:57745874-57745896 TTTTTGAGAAAGAGTCACCCAGG - Intergenic
956438728 3:69259815-69259837 TTTTAGAAATGGGGTCACCCAGG + Intronic
956470227 3:69558754-69558776 TTTTTGAGACGAAATCGCCCAGG - Intergenic
956913138 3:73842247-73842269 TTTTAGAGAGAGGGTTGCCCAGG - Intergenic
957420829 3:79967631-79967653 TTTTTGAGCTGGAGTCATCCAGG + Intergenic
958018815 3:87972977-87972999 TAGTAGAGATGGAGTTGGCCAGG - Intergenic
959298264 3:104565617-104565639 TTTTTGAGACGGAGTCGCCCAGG - Intergenic
960583566 3:119300813-119300835 TTTTTGAGATGGAGTCAGTCTGG - Intronic
961193459 3:124981926-124981948 TTTTTGAGACGGAGTCGCCCAGG + Intronic
961511009 3:127403571-127403593 CATTCGAGATGGAGTTGCCCTGG + Intergenic
961768579 3:129231373-129231395 TTTTTAAGATGGAGTTGCCCAGG - Intergenic
961945248 3:130680043-130680065 TTTTTGAGATGGAGTCTTGCTGG - Intronic
961989495 3:131172692-131172714 TATTCAAGATGGAGTCGCTCTGG - Intronic
962095249 3:132286217-132286239 TTTTCAAGATGGAGTTGCTCTGG - Intergenic
962735702 3:138323388-138323410 TTTTTGAGACGGAGTCACCCAGG - Intronic
962869999 3:139480467-139480489 ATTCAGAAATGGAGTCACCCAGG - Intronic
963030734 3:140972594-140972616 TTTAACAGATGGAGTCTCCATGG - Intronic
963189754 3:142456234-142456256 TGTTTGAGACAGAGTCGCCCAGG - Intronic
963927462 3:150966126-150966148 TTGTAGAGATGGGGTTGCCCAGG - Intronic
963983053 3:151561996-151562018 TTTTCAAGATGGAGTTGCTCTGG - Intergenic
964128758 3:153264442-153264464 TTTTTGAGATGGAGTCGACCAGG - Intergenic
964211431 3:154232851-154232873 TTTTTGAGACGGAGTCACCCAGG + Intronic
964463458 3:156963367-156963389 TTTTACACATGGACTCACCCAGG + Intronic
964687535 3:159413726-159413748 TTTTAGAGTTGGAAGAGCCCTGG - Intronic
964827449 3:160844408-160844430 TTTTAGAGATGAAGAAGCCGAGG - Intronic
965131966 3:164712064-164712086 TTTTTGAGATGGAGTTCTCCAGG - Intergenic
965529112 3:169753314-169753336 TTTTTCAGATGGAGTTGCCCAGG + Intergenic
965628453 3:170706193-170706215 TTTTTGAGATGGAGTTGCCCAGG + Intronic
965799682 3:172479013-172479035 TTTTTTAGATGGAGTCTCACTGG + Intergenic
965819415 3:172669560-172669582 TTTTTGACATGGAGTCACCCAGG + Intronic
966032852 3:175371796-175371818 TTTAATAGATGGAGTTGTCCAGG - Intronic
966189237 3:177256692-177256714 TTGTAGAGATGGGGTTACCCAGG + Intergenic
966368523 3:179219256-179219278 TTCTAGAGATGAAGTAGCCCAGG + Exonic
966409959 3:179637676-179637698 TTTTTGTGACGGAGTTGCCCAGG + Intergenic
966438516 3:179917683-179917705 TTTTTGAGACGGAGTTGCCCAGG + Intronic
966769375 3:183490777-183490799 TTTTTGAGATGAAGTCGCCCAGG - Exonic
966812859 3:183863728-183863750 TTATAGAAATGGAATCGGCCGGG - Intronic
966994433 3:185266076-185266098 TTTTTGAGACGGAGTCTCCCTGG + Intronic
967193933 3:187010476-187010498 TTTTTGAGATGGAGTTGTCCAGG + Intronic
967601176 3:191390865-191390887 TATTAAAGATGGAGTCTCTCTGG + Intronic
967671001 3:192235322-192235344 TTTTTGAGACGGAGTCTCCCTGG + Intronic
967735507 3:192947809-192947831 TTTTTGAGACAGGGTCGCCCAGG + Intergenic
967798738 3:193629643-193629665 TTTTTGAGACGGAGTCGCCCAGG - Intronic
967918571 3:194597632-194597654 TTTTTGAGACAGAGTCACCCAGG - Intronic
968042851 3:195602267-195602289 TATTCTAGATGGAGTCGCTCTGG + Intergenic
968203165 3:196773844-196773866 TTTTTGAGATTCTGTCGCCCAGG - Intronic
968217381 3:196904937-196904959 TTTTTGAGATGGAGTCTTTCAGG + Intronic
969272970 4:6115382-6115404 ATTTTGAGATGGAGTCTCCCAGG - Intronic
969294189 4:6259771-6259793 TTTTTGAGACAGAGTCGCCCAGG - Intergenic
969366446 4:6697485-6697507 TTGGAGAGATGGAGGGGCCCAGG - Intergenic
969458521 4:7314855-7314877 TTTTTGAGATGGAGTTGCCCAGG + Intronic
969553537 4:7889525-7889547 TTTTTGGGATGGAGTTGCCCAGG - Intronic
969928924 4:10611579-10611601 TTCTAGAGAAGGAGCCCCCCAGG + Intronic
970433618 4:16012020-16012042 TTTTTGAGAGAGAGTCGCCCAGG + Intronic
970858371 4:20674378-20674400 CTTTTGAGATGGAGTCACCCAGG + Intergenic
971290386 4:25332280-25332302 TTTTTGAGATGGAGTCACCCAGG - Intronic
971325469 4:25639919-25639941 TTTTTGAGACGGAGTCGCCCAGG + Intergenic
971336185 4:25726067-25726089 TATTCAAGATGGAGTCCCCCTGG + Intergenic
971344125 4:25796749-25796771 TTTTCGAGATAGAGTCCCTCTGG - Intronic
971799570 4:31271179-31271201 ATTTTGAAATGGAGTTGCCCAGG + Intergenic
972987844 4:44786419-44786441 TTTTTGAGATAAAGTTGCCCAGG - Intergenic
973697499 4:53505274-53505296 TTTTTGAGATGGAGTCACCCAGG + Intronic
974961962 4:68713572-68713594 GTTTTGAGATGGAGTCTCGCTGG - Intergenic
975176337 4:71293535-71293557 TTTTTTAGACGGAGTCGCCCAGG - Intronic
975559164 4:75693493-75693515 TTTAAGAGTTGGAGTCTGCCAGG + Intronic
975594850 4:76040307-76040329 TTTTTGAGACGGAGTCTCTCTGG - Intronic
976181085 4:82399485-82399507 TTTTTGAGTTGGGGTCGCCCAGG + Intergenic
976261041 4:83144914-83144936 TTTCTGAGACGGAGTCTCCCAGG - Intergenic
976590870 4:86848776-86848798 TGTTAGAGATGGTGCCCCCCGGG + Exonic
976729421 4:88246902-88246924 TTGTAGAGATGGAATTTCCCAGG + Intergenic
976800076 4:88979943-88979965 TTTTTGAGTTGGAGTCACCCAGG - Intronic
977049108 4:92104298-92104320 TGGTAGAGATGGAGTCTCCCTGG + Intergenic
977209774 4:94205821-94205843 TTTTTGAGATGGAGTTGCCCAGG + Intergenic
977497278 4:97793126-97793148 TTTTTGAGATGGTGTCGCCCAGG - Intronic
977543408 4:98346568-98346590 TTTTTGAGAGGGAGTCGCCCAGG + Intronic
978240062 4:106504629-106504651 TTTTATAAATGGAGTTCCCCTGG + Intergenic
978430349 4:108626732-108626754 TTTAAGAGATGGTGTTGGCCGGG - Intronic
978538740 4:109792537-109792559 TTTTTGAGATGGAGTCATCCAGG - Intronic
978558850 4:110010227-110010249 GTTTTGAGATGGAGTCTCACTGG - Intronic
978703861 4:111681580-111681602 TATTCAAGATGGAGTCGCTCTGG - Intergenic
978741679 4:112144995-112145017 TAGTAGAGATGGGGTTGCCCAGG + Intergenic
978775865 4:112506417-112506439 TCTTTGAGATGGAGTCGCCAAGG - Intergenic
979752195 4:124292231-124292253 TTTTTGAGATGGAGTCTCAATGG - Intergenic
979859913 4:125681068-125681090 TTTTTGAGAAGGAGTCTCGCTGG - Intergenic
980014242 4:127630366-127630388 TATTCAAGATGGAGTCGCTCTGG + Intronic
980036815 4:127894250-127894272 TTTTTGAGACGGAGTCACCCAGG + Intronic
980042589 4:127956091-127956113 TTTTTGAGGTGGAGTCGCCCAGG - Intronic
980213280 4:129817597-129817619 ATTTGGAGATTGAGTCACCCAGG - Intergenic
981980558 4:150786266-150786288 TTTTTGAGATGGAGTCGCCTGGG + Intronic
982003049 4:151038629-151038651 TATTCAAGATGGAGTCGCTCTGG - Intergenic
982242037 4:153309647-153309669 TTTTTGAGATGGAGTCTTGCAGG + Intronic
982697339 4:158616971-158616993 TTTTTGAGATGGAGGCACTCAGG - Intronic
983189154 4:164735985-164736007 TTTTTGAGATGAAGTTGCCCAGG - Intergenic
983196425 4:164811574-164811596 TTTTTGAGACAGAGTCGCCCAGG - Intergenic
983401168 4:167268198-167268220 TATTAAAGATGGAGTTGCTCTGG - Intergenic
984152570 4:176152578-176152600 TTTTTGAGATGGAGTTACCCAGG - Intronic
984601200 4:181728817-181728839 TTTTCAAGATGGAGTCGCTCTGG + Intergenic
984613877 4:181873808-181873830 GTTTTGAGATGGAGTCACCCAGG + Intergenic
984750361 4:183267044-183267066 TTTAAGAGATGGGGTCTCACTGG + Intronic
985101039 4:186458871-186458893 TGTTCAAGATGGAGTCGCTCTGG + Intronic
985102950 4:186476090-186476112 TTTTTGAGATGGAGTCTCGCTGG + Intronic
985143486 4:186867262-186867284 TTTGAGAGATGGAGAGACCCAGG + Intergenic
985155572 4:186983983-186984005 TATTCAAGATGGAGTCGCTCTGG - Intergenic
985173629 4:187177932-187177954 TTTAAGAGATGGGGTCGCCTAGG + Intergenic
986128198 5:4903081-4903103 TTTTGGAGACAGAGTCACCCAGG - Intergenic
986186510 5:5446185-5446207 TTGTAGAGATAGGGTTGCCCAGG + Intronic
986211907 5:5681985-5682007 TTTTAGAGATAGAGAGGGCCTGG + Intergenic
987072730 5:14353287-14353309 TTTTTGAGACTGAGTCGCCCAGG + Intronic
987281348 5:16416748-16416770 TTTTTGAGACAGAGTCACCCAGG - Intergenic
987334200 5:16884367-16884389 TTTTGGAGACAGAGTCTCCCAGG - Intronic
988183972 5:27835914-27835936 TTTTTGAGACGGAGTTGCCCAGG - Intergenic
988295486 5:29354921-29354943 TTTTCAAGATGGAGTTGCTCTGG - Intergenic
988457798 5:31402817-31402839 ATTTAGAGATGGAATCTCGCTGG + Intronic
988500441 5:31779389-31779411 TTTTTGAGATGGAGTCTTGCTGG + Intronic
988825801 5:34933299-34933321 TTTTAGAGATGGAGTCTTGCTGG + Intronic
988831294 5:34989911-34989933 TGTTCAAGATGGAGTCGCTCTGG - Intergenic
989055932 5:37366675-37366697 TTTTTGAGACGGAGTCTCACAGG + Intronic
989130193 5:38099622-38099644 TATTCAAGATGGAGTCGCTCTGG - Intergenic
989621081 5:43384920-43384942 TTTTTGAGACGGAGTCACCCAGG + Intronic
990560233 5:56976604-56976626 TTTTAGAGATGAAGTTGCTCAGG + Intergenic
991439866 5:66635701-66635723 TTTTTGAGACAGAGTTGCCCAGG + Intronic
991572389 5:68068913-68068935 CTTTTGAGATGGAGTCACCCAGG + Intergenic
991676080 5:69091186-69091208 TATTCAAGATGGAGTTGCCCCGG + Intergenic
991678281 5:69111007-69111029 TTTTTGAGATGGAGTCTCACTGG + Intronic
992197858 5:74357454-74357476 TTTTAGAGATGATGTCACCCAGG - Intergenic
992400765 5:76409087-76409109 TTTTAGAGATGGGGTCTCACTGG - Intronic
992437327 5:76767583-76767605 TTTTGGAGACAGAGTCACCCAGG + Intergenic
992782393 5:80140136-80140158 TTGTAGAGATGGGGTTGTCCAGG - Exonic
992792856 5:80229047-80229069 TTTTGGGGATGGAGTTGCCTAGG + Intronic
992824575 5:80536184-80536206 TTTTTGAGATGGAGTCTCACTGG + Intronic
992963872 5:81982430-81982452 TTTTGGAGACGGAATCGCCCAGG - Intronic
993536766 5:89095936-89095958 TTTTTGAGACGGAGTCTCACAGG - Intergenic
993593562 5:89825683-89825705 TTTTTGAGATGGAGTCGCCCAGG + Intergenic
994375028 5:99009359-99009381 TTTTTGAGATGGAGTCACACAGG - Intergenic
995704161 5:114968607-114968629 TTTTTCAGATGGGGTCACCCAGG - Intergenic
995789690 5:115872120-115872142 TTGTAGAGATGGGGTTGCCCAGG - Intronic
996406434 5:123110286-123110308 TTTTTGAGATGGAGTCTTGCTGG + Intronic
996716038 5:126589022-126589044 TTTTTAAGACAGAGTCGCCCAGG - Intronic
996858747 5:128040912-128040934 TTTTTGAGATGGAGTCACCCAGG - Intergenic
997033401 5:130158232-130158254 TATTCAAGATGGAGTCGCTCTGG + Intronic
997325725 5:133019187-133019209 TTTTAGAGACAGTGTTGCCCAGG - Intronic
998086651 5:139331893-139331915 TTTTTGAGACTGTGTCGCCCAGG + Intergenic
998207393 5:140167942-140167964 TTTTTGAGATAGAGTTGCCCAGG + Intergenic
998610184 5:143680408-143680430 TTTTTGAGATAGAGTCTCACTGG + Intergenic
998672491 5:144369325-144369347 TTTTAGAGATGAAATAGCACAGG + Intronic
999667198 5:153925235-153925257 TTTTTTAGATGAAGTCTCCCAGG - Intergenic
1000211846 5:159114518-159114540 TTTTTGAGACAGAGTCTCCCAGG - Intergenic
1000229987 5:159306864-159306886 TTTTAGAGACAGGGTCACCCAGG + Intergenic
1000325287 5:160167456-160167478 TGTTCAAGATGGAGTCGCTCTGG + Intergenic
1000370989 5:160536468-160536490 TATTCAAGATGGAGTCGCTCTGG - Intergenic
1000748177 5:165061742-165061764 TTTTTGAGATGGAGTCGCCCAGG + Intergenic
1001050865 5:168413241-168413263 CTTTAGAGATGGGGTGGCCAGGG + Intronic
1001070520 5:168580945-168580967 TATTCAAGATGGAGTCGCTCTGG - Intergenic
1001616668 5:173048413-173048435 TTTTAAAGACAGAGTTGCCCAGG + Intergenic
1001736590 5:174008805-174008827 TTTTTGAGATGGAGTCACCCAGG - Intergenic
1001995150 5:176151426-176151448 TTTTAGAGACAGAGTCTCACTGG + Intergenic
1002099311 5:176849557-176849579 TTTTTGAGACGCAGTTGCCCAGG - Intronic
1002155493 5:177275457-177275479 TTTTTGAGATGGAGTCGCCCAGG + Intronic
1002351054 5:178584039-178584061 TTTTTGAGATGTACTCACCCAGG + Intronic
1002371923 5:178761673-178761695 TTTTTGAGACAGAGTCGCCCAGG - Intergenic
1002391395 5:178915341-178915363 TTTTTGAGATGGAGTCAGGCTGG + Intronic
1003776247 6:9368785-9368807 TATTCAAGATGGAGTCACCCTGG + Intergenic
1003876627 6:10443442-10443464 TTTTTGAGACAGAGTCACCCAGG - Intergenic
1003901898 6:10662320-10662342 TATTCAAGATGGAGTCGCTCTGG - Intergenic
1004098783 6:12586828-12586850 TATTCGAGATGGAGTTGCTCTGG - Intergenic
1004177883 6:13356108-13356130 TTTTTTAGATCGAGTCACCCAGG + Intergenic
1004375143 6:15084452-15084474 TTTTTGAGATGGAGTCTCGCTGG - Intergenic
1004405846 6:15332955-15332977 TTTTGGAGACGGAGTCGCCCAGG + Intronic
1004408639 6:15359726-15359748 TATTTGAGATGGAGTCTCCCAGG + Intronic
1004496070 6:16164463-16164485 TTTTAGAGACGGGGTCACCCAGG + Intergenic
1005025689 6:21460895-21460917 TTTTTGAGATAGAGTCTCCCAGG - Intergenic
1005086710 6:22014770-22014792 TTTTTGAGACGAAGTCTCCCAGG + Intergenic
1005450773 6:25969945-25969967 TTTTTGAGATGGAGTCTTGCTGG + Intronic
1006015964 6:31080884-31080906 CTTTTGAGATGGAGTCACCCAGG - Intergenic
1006356186 6:33559558-33559580 TTTTTGAGATGGGGTCACCCAGG - Intergenic
1006461185 6:34159504-34159526 TTTTTGAGATGGAGTCACCCAGG - Intergenic
1006499239 6:34447319-34447341 TTTTTGAAACAGAGTCGCCCAGG - Intergenic
1006546227 6:34784240-34784262 TTTTTGAGACAGAGTCACCCAGG - Intergenic
1006608090 6:35273703-35273725 TTTGTGAGATGGAGTCTCCCGGG - Intronic
1006770700 6:36550143-36550165 TTTTTGAGACGGGGTCACCCAGG + Intergenic
1006791655 6:36705093-36705115 TTTTTGAGATGGAGTCACCCAGG - Intronic
1006977829 6:38120349-38120371 TTGTGGAGACGGAGTCGCCCAGG + Intronic
1007331226 6:41111007-41111029 TTTTTGAGATTCTGTCGCCCAGG - Intergenic
1007463445 6:42034771-42034793 TTTAAGAGACAGAGTCGGCCAGG - Intronic
1007523794 6:42473399-42473421 TTTTTGAGATGGCGTCGGGCCGG + Intergenic
1007796149 6:44349271-44349293 TTTTTGAGCCAGAGTCGCCCAGG - Intronic
1008182909 6:48355637-48355659 TATTCCAGATAGAGTCGCCCTGG + Intergenic
1008537858 6:52520932-52520954 TTTTTGAGACAGAGTCACCCAGG + Intronic
1008626127 6:53318317-53318339 TTTCAGACATGTACTCGCCCAGG - Intronic
1010188125 6:73165917-73165939 TTTTTGAGACGGAGTCACCCAGG - Intronic
1011063694 6:83300629-83300651 TTTTTGAGATGGAGTTGTGCAGG + Intronic
1011410962 6:87065649-87065671 TTTTTGAGATGGAGTCAGGCTGG - Intergenic
1012409252 6:98937282-98937304 TTTTTGAGACGAAGTCACCCAGG - Intronic
1013043431 6:106460039-106460061 TTTTTGAGACAGAGTCGCCCAGG + Intergenic
1013476235 6:110509831-110509853 TATTTGAGATGGAGTTGCTCTGG - Intergenic
1013476742 6:110514818-110514840 TTTTTGAGATGGTGTCTCTCTGG + Intergenic
1013518871 6:110914592-110914614 TTTTAGAGATGGGGTCTCACAGG + Intergenic
1013556481 6:111261473-111261495 TTGTAGAGATGGGGTTGCCTAGG + Intronic
1013887561 6:114988614-114988636 TTTTTGAGACAGAGTCTCCCAGG + Intergenic
1013944238 6:115703718-115703740 TTTTAGAGTTTGAGTCTGCCAGG + Intergenic
1015236110 6:130973084-130973106 TTTTTGAGATGGAGCCACTCAGG - Intronic
1015576978 6:134682121-134682143 TTTCTGAGACGGAGTCGCCCAGG + Intergenic
1015888885 6:137949117-137949139 TGTTTGAGATGAAGTTGCCCAGG - Intergenic
1016270830 6:142288702-142288724 TTTTTGAGACAGAGTCACCCAGG + Intergenic
1016273283 6:142315803-142315825 TATTTGAGATGTAGTTGCCCAGG - Intronic
1016294065 6:142555038-142555060 TTTTAGAGATGGAGCCAGCTGGG - Intergenic
1016470349 6:144368746-144368768 TTTTTGCGACGGAGTTGCCCAGG - Intronic
1016760399 6:147730057-147730079 TTTTTGAGACAGAGTCACCCAGG - Intronic
1017069455 6:150561064-150561086 TTTTTGATATGGAGTTGCCCAGG - Intergenic
1017110564 6:150928565-150928587 TTTTTGAGATGAAGTCACCCAGG + Intronic
1017248160 6:152250236-152250258 TTTTTGAGATAAAGTCACCCAGG - Intronic
1017256048 6:152334855-152334877 TATTCAAGATGGAGTCGCTCTGG + Intronic
1017406398 6:154124017-154124039 TATTCAAGATGGAGTCGCTCTGG + Intronic
1017739315 6:157392888-157392910 TTTTTGAGATGGAGTTGCCCAGG + Intronic
1017814048 6:158004166-158004188 TATTCAAGATGGAGTCGCTCTGG - Intronic
1017993696 6:159511919-159511941 TATTCAAGATGGAGTCGCTCTGG + Intergenic
1018007258 6:159633923-159633945 TTTTTGAGACAGAGTCGGCCGGG - Intergenic
1018276044 6:162132735-162132757 TTTCAGAGATAGAGATGCCCTGG - Intronic
1018494754 6:164337830-164337852 TATTCAAGATGGAGTCGCTCTGG - Intergenic
1018835681 6:167481776-167481798 TTTTCAAGATGGAGTCACTCTGG + Intergenic
1019004713 6:168786751-168786773 TATTAGAGATGAGGTTGCCCAGG + Intergenic
1019115906 6:169762264-169762286 TTGTAGAGATGGGGTTTCCCAGG + Intronic
1019269094 7:136136-136158 TATTCAAGATGGAGTCGCTCTGG - Intergenic
1019483920 7:1279312-1279334 TCGTAGAGATAGAGTTGCCCAGG - Intergenic
1019584259 7:1788303-1788325 TTTTTGAGACAGAGTCACCCAGG - Intergenic
1019652487 7:2167702-2167724 TTTAAGAGATGAGGTTGCCCAGG - Intronic
1019951108 7:4373458-4373480 TTGTAGAGATGGGGTTGCCCAGG + Intergenic
1020069564 7:5217476-5217498 TTGTAGAGATGGAGTCTTGCTGG + Intronic
1020096530 7:5372521-5372543 TAGTAGAGATGGAGTCTTCCAGG - Intronic
1020197998 7:6057223-6057245 TTAAAGAGATGGGGTCGTCCGGG - Intronic
1020221320 7:6240275-6240297 TTTTTGAGATGGAGTCTCCCAGG - Intronic
1021121040 7:16796134-16796156 TTTTAAAGATCAAGTTGCCCAGG - Intronic
1021682253 7:23145754-23145776 TTTTTGAGACAGAGTCTCCCAGG + Intronic
1021722945 7:23521456-23521478 TTTCAGAGATAGGGTCTCCCTGG + Intronic
1021874423 7:25035234-25035256 TTTTTGAGATGGAGTCTCACTGG - Intergenic
1022618405 7:31956117-31956139 TTTTTGAGACAGAGTCGCCCAGG + Intronic
1023754836 7:43406891-43406913 TTTTTGAGATGGAGTCACCCAGG - Intronic
1023805012 7:43866733-43866755 GTTTGGAGGTGGAGTCGCACAGG + Exonic
1023823656 7:43994512-43994534 TTTTTGAGACGGAGTCAGCCTGG + Intergenic
1023933701 7:44723959-44723981 TATTCAAGATGGAGTCGCTCTGG + Intergenic
1023961889 7:44934240-44934262 TTATAGAGATGGGGTTGCCCAGG + Intergenic
1024261683 7:47578290-47578312 TTTTTGAGATGGAGTCTTGCTGG - Intronic
1024630014 7:51239150-51239172 TATTCGAGATGGAATCGCTCTGG - Intronic
1024816380 7:53276268-53276290 TTTTGGAGATGGAGTCTCCCAGG + Intergenic
1024834833 7:53504573-53504595 TTTTAGAGATGAAGAAGCTCAGG - Intergenic
1024976675 7:55119883-55119905 TGTTAGAGATGCAGTTGGCCAGG + Intronic
1025168637 7:56735949-56735971 TTTTTGAGAAGGAGTCGCCGAGG + Intergenic
1025703751 7:63843932-63843954 TTTTTGAGAAGGAGTCACCGAGG - Intergenic
1025799501 7:64772358-64772380 TTTTTGAGACGGAGTCGCCCAGG + Intergenic
1025951522 7:66149330-66149352 TTGTAGAGATGGGGTTGCCCAGG - Intronic
1026066101 7:67074054-67074076 TTTTTGAGATGGAGTAGCCCAGG - Intronic
1026146175 7:67748721-67748743 TGTTTGAGATGGAGTCACCCAGG + Intergenic
1026187921 7:68097870-68097892 TTTTTGAGATGGAGTCTAGCTGG + Intergenic
1026261995 7:68763451-68763473 ATTTTGAGATAGAGTCACCCTGG - Intergenic
1026434723 7:70385708-70385730 TTTTAGAGACAGTGTTGCCCAGG - Intronic
1026625680 7:71989975-71989997 TATTCAAGATGGAGTCACCCTGG - Intronic
1026710780 7:72737798-72737820 TTTTTGAGATGGAGTAGCCCAGG + Intronic
1026971332 7:74470007-74470029 TTTTAGAGATAGGGTTGGCCAGG + Intronic
1027395658 7:77751167-77751189 TTTTTGAGATGGAGTCAGACTGG + Intronic
1027400949 7:77806147-77806169 TTTTTGAGATGGAGTCACCCAGG - Intronic
1027464118 7:78493503-78493525 TTTTATAGATGGAGAAACCCAGG + Intronic
1027504764 7:79002333-79002355 TTGTAGAGATGGGGTTTCCCAGG + Intronic
1029119193 7:98255131-98255153 TGTTCAAGATGGAGTCGCTCGGG - Intronic
1029269751 7:99370048-99370070 TTTTTGAGATGGAGTCTCGCTGG - Intronic
1029273657 7:99392009-99392031 TTTTTGAGATGGAGTCTCGGTGG - Intronic
1029297222 7:99551047-99551069 TTTTTGAGACAGAGTCGCCCAGG - Intronic
1029299495 7:99568274-99568296 TTTTTGAAATGGAGTCTCCCAGG + Intronic
1029348169 7:99993642-99993664 TTTTTGAGACGGAGTCACCCAGG - Intergenic
1029350389 7:100009300-100009322 TTGTAGATATGGAGTCTCCCTGG - Intergenic
1029477406 7:100793154-100793176 TTATAGAGATGGGGTCTCACTGG - Intronic
1029480494 7:100809537-100809559 TTTAAGAGATGGGATCGCCCAGG + Intronic
1029498968 7:100915790-100915812 TTATAGAGATGGAGTCTCACCGG - Intergenic
1029883746 7:103845214-103845236 TTGTTGAGATTGAGTCACCCAGG + Intronic
1030052516 7:105551209-105551231 TTGTAGAGATGGGGTTTCCCTGG + Intronic
1030300931 7:107973970-107973992 TTTTAGAGATGGGGTCTTGCTGG + Intronic
1030353622 7:108519347-108519369 TTTTAGAGATGGGGTCTCTGTGG - Intronic
1030559430 7:111066002-111066024 TTTTTGAGATGAAGTCTCCCAGG + Intronic
1030699683 7:112624008-112624030 TATTAGAGATGGAGTTGCTCTGG + Intergenic
1031042110 7:116849510-116849532 TTTTTGAGATGGAGTCTCCCAGG - Intronic
1031085387 7:117297359-117297381 TGGTAGAGATGGAGTTGCCCAGG + Intronic
1031416667 7:121503942-121503964 TATTAAAGATGGAGTTGCTCTGG - Intergenic
1032136148 7:129280057-129280079 TATTTAAGATGGAGTCGCCTTGG + Intronic
1032343629 7:131099287-131099309 TTTTAGAAATGGAGTCTCGCTGG - Intergenic
1032385602 7:131521140-131521162 TTTTTGAGATGGAGTCGCCCAGG - Intronic
1032986810 7:137346239-137346261 TATTCAAGATGGAGTCGCTCTGG + Intergenic
1033308407 7:140241461-140241483 TTTTTGAGAGAGTGTCGCCCAGG + Intergenic
1034001129 7:147414644-147414666 TTTAAGAAATGGATTCTCCCAGG + Intronic
1034006935 7:147483018-147483040 TTTTTGAGACAGAGTCACCCAGG - Intronic
1034093765 7:148387813-148387835 TATTCGAGATGGAGTTGCTCTGG - Intronic
1034328949 7:150265666-150265688 TTTTTGAGATGGAGTTGCCCAGG - Intronic
1034388592 7:150763662-150763684 TTTTTGAGATGGAGTCTCACAGG + Intergenic
1034524922 7:151652659-151652681 TTTTTGAGATGGGGTCACCCAGG + Intronic
1034645836 7:152646500-152646522 TTTTAGAGATGGAGTCGCCCAGG + Exonic
1034669100 7:152844081-152844103 TTTTTGAGATGGAGTTGCCCAGG + Intronic
1034776733 7:153834259-153834281 TTTTTTAGATGGAGTCACCCAGG - Intergenic
1035208297 7:157309254-157309276 TGTTCCAGATGGAGTCGCTCTGG + Intergenic
1036492284 8:9238809-9238831 TTGTAGGGAAGGAGTCTCCCAGG - Intergenic
1036731197 8:11266717-11266739 TTATAGAGATGGGGTTGCCCCGG + Intergenic
1037278005 8:17202244-17202266 TTTTTGAGACGGAGTTGCCTAGG + Intronic
1037399460 8:18479342-18479364 TTGTGGAGATGAAGTCTCCCAGG + Intergenic
1037878295 8:22560039-22560061 TTTTTGAGACTGAGTCACCCAGG - Intronic
1038288270 8:26225844-26225866 TTTTTGAAACGGAGTTGCCCAGG + Intergenic
1038338841 8:26667245-26667267 TATTCAAGATGGAGTCGCTCTGG - Intergenic
1038421184 8:27434981-27435003 TTTTTGAGATGGAGTCTTGCTGG - Intronic
1038548361 8:28443607-28443629 TATTCAAGATGGAGTTGCCCTGG - Intronic
1038655540 8:29447828-29447850 TATTTAAGATGGAGTGGCCCTGG - Intergenic
1038759765 8:30375566-30375588 TTTTAGAGATAGGGTCTGCCAGG - Intergenic
1038767374 8:30441817-30441839 TTTTTGAGACGGAGTCTCGCTGG + Intronic
1038930435 8:32188080-32188102 TTTTTGAGATGAAGTCTCACTGG + Intronic
1039774185 8:40719593-40719615 TTTTTGAGACGGAGTCACCCAGG + Intronic
1039973885 8:42343499-42343521 TTTTTGAGATGGAGTCACCCAGG - Intronic
1039979941 8:42400693-42400715 TTTTTGAGATGGAGTCTTGCTGG + Intronic
1040023016 8:42757338-42757360 TTTTCCAGATAGAGTCACCCAGG - Intronic
1041126628 8:54647397-54647419 TTTTTGAGAGGGAGTCTCGCTGG - Intergenic
1041763233 8:61389515-61389537 TTTTTGAGATGGAGTCGCCCAGG - Intronic
1042256026 8:66804896-66804918 TTGTAGAGATGAGGTTGCCCAGG - Intronic
1042366513 8:67943285-67943307 TTTTTGAGAAGGAGTCACCCAGG + Intergenic
1042585192 8:70329430-70329452 TTGTAGAGATGGAGTCTCCCAGG + Intronic
1042868637 8:73378002-73378024 TTTTTGAGACGGAGTCACCCAGG + Intergenic
1042948338 8:74176601-74176623 TATTCGAGATGGAGTTGCTCTGG - Intergenic
1043004142 8:74797011-74797033 TATTCAAGATGGAGTCGCTCTGG + Intronic
1043645823 8:82517362-82517384 TTTTTAAGATGGTGTCACCCTGG - Intergenic
1044231635 8:89785426-89785448 TTTTTGAGGTGGAGTCGCCCAGG - Intronic
1044288013 8:90432127-90432149 TTTTTGAGATGGATTCAGCCTGG + Intergenic
1044993955 8:97821308-97821330 TTTTTGAGATGGAGTCGCCCAGG - Intronic
1044999507 8:97868158-97868180 TTTTTGAGACGGAGTCGCCCAGG - Intergenic
1045004896 8:97909122-97909144 TGGTAGAGATGGGGTTGCCCAGG + Intronic
1045010685 8:97956201-97956223 TTTTTGAGATGGAGTTTCCCAGG + Intronic
1046206046 8:110998851-110998873 TTTTTGAGACGGAGTCACCCAGG - Intergenic
1046675678 8:117105203-117105225 TGTTAAAGATGGAGTTGCTCTGG + Intronic
1046899248 8:119506122-119506144 TTTTTGAGATGGAGTCACCCAGG - Intergenic
1047142636 8:122158419-122158441 TTTTTGAGATGGAGTCTCGCTGG - Intergenic
1047936571 8:129786304-129786326 TTTTTGAGACGGAGTTGCCCAGG - Exonic
1048554481 8:135461114-135461136 TTTTTGAGACGAAGTTGCCCAGG + Intronic
1049090940 8:140512841-140512863 TTTTTGAGATGGAGTTTCCCAGG + Intronic
1050474917 9:6031169-6031191 TTTAAGAGATGGGGTTGCCTAGG + Intergenic
1050538660 9:6651381-6651403 TTTTTGAGATGGGGTCTCGCTGG - Intergenic
1050563215 9:6855920-6855942 TTATAGAGATGGGGTCTCGCTGG + Intronic
1051156134 9:14148303-14148325 TTGTAGAGAGGGAGTTGTCCAGG + Intronic
1051409933 9:16779085-16779107 TTGTAGAGATGGAGTAACCTAGG - Intronic
1051906901 9:22105910-22105932 TTTTTGAGATGGAGTCAGTCTGG + Intergenic
1052038512 9:23710734-23710756 TTTTAAAGATGGAGTCTTCGTGG + Intronic
1052197565 9:25736143-25736165 TTATATAGATGAAGTCTCCCAGG - Intergenic
1053223723 9:36333334-36333356 TTTTTGAGATGGAGTCTCGCTGG + Intergenic
1053548437 9:39048809-39048831 TTTTTGAGACGGAGTCTCGCTGG + Intergenic
1053812559 9:41868873-41868895 TTTTTGAGACGGAGTCTCGCTGG + Intergenic
1054618036 9:67318566-67318588 TTTTTGAGACGGAGTCTCGCTGG - Intergenic
1054796554 9:69307528-69307550 TATTCGAGATGGAGTTGCTCTGG + Intergenic
1055855172 9:80677217-80677239 TTTTTCAGATGGAGTTGCCCAGG - Intergenic
1055952465 9:81743254-81743276 TTTTTGAGACGGAGTCTCCCTGG + Intergenic
1055959302 9:81805150-81805172 TTTTTGAGATGGAGTTGCCCAGG + Intergenic
1056167240 9:83951238-83951260 TTTTTGAGATGGAGTCTTGCTGG - Intronic
1056215168 9:84399793-84399815 TTTTTGAGGCGGAGTCGCCCAGG + Intergenic
1056594222 9:87992835-87992857 TTTTTGAGACGGAGTTGCCCAGG + Intergenic
1056629648 9:88282685-88282707 TTTTAGAGACAGAGTCTTCCAGG + Intergenic
1057147621 9:92768852-92768874 TATTTGAGATGGAGTTGCTCTGG - Intergenic
1057364095 9:94402224-94402246 TATTCAAGATGGAGTCGCTCTGG + Intronic
1057659241 9:96985837-96985859 TATTCAAGATGGAGTCGCTCTGG - Intronic
1057720744 9:97529946-97529968 TTTTAAAGATGGAGAAGCCGAGG + Intronic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1057898236 9:98926747-98926769 TTTTTGAGATGGAGTCTCCCAGG + Intergenic
1058461498 9:105188200-105188222 TTTTTGAGACGGAGTCGCCCAGG + Intergenic
1059066428 9:111090433-111090455 TTTTTGAGATGGAGTCACCCAGG - Intergenic
1059104549 9:111500496-111500518 TTTTTGAGACGGAGTCGCCCAGG + Intergenic
1060163464 9:121388349-121388371 TATTAAAGATGGAGTCACTCTGG + Intergenic
1060184475 9:121555722-121555744 TTTAAGAGACAGAGTCACCCAGG + Intergenic
1060753496 9:126191109-126191131 TTTTTGAGATAGGGTCGGCCAGG - Intergenic
1060855152 9:126909227-126909249 TTTTTGAGACGGAGTCTCACTGG + Intergenic
1060947871 9:127580824-127580846 TTTAAGAGATGTAATTGCCCAGG + Intergenic
1061045978 9:128165281-128165303 TTTTTGAGATGGAGTCACCTAGG + Intergenic
1061347319 9:130037027-130037049 TTTTTGAGATGGAGTCTCGCTGG - Intronic
1061376598 9:130229278-130229300 TTTCCAAGATGGAGTCTCCCAGG + Intronic
1061554134 9:131356171-131356193 TTTTTGAGATGGAGTCATCCAGG - Intergenic
1061850674 9:133413112-133413134 TTTTTGAGATGGAGTCTCACTGG + Intronic
1185709641 X:2293204-2293226 TTTTAGCGATGGAGACCCACTGG - Intronic
1185769612 X:2755609-2755631 TATTCAAGATGGAGTCGCTCTGG + Intronic
1185783976 X:2874068-2874090 TTTTTGAGACAGAGTCACCCAGG - Intronic
1185823575 X:3227665-3227687 TATTCAAGATAGAGTCGCCCTGG - Intergenic
1185894985 X:3850059-3850081 TTTTTGAGATGAAGTTTCCCAGG - Intergenic
1185900103 X:3888484-3888506 TTTTTGAGATGAAGTTTCCCAGG - Intergenic
1185905219 X:3926912-3926934 TTTTTGAGATGAAGTTTCCCAGG - Intergenic
1185979211 X:4757464-4757486 TTTCAGAGATAGAGTCGCCCAGG + Intergenic
1186093758 X:6078108-6078130 TCTTTGAGATGGAGTGGCCAGGG - Intronic
1187871746 X:23770514-23770536 GTTTTGAGATGGAGTCTCCTAGG + Intergenic
1187896125 X:23981095-23981117 TTTTTGAGAGAGAGTCACCCAGG - Intergenic
1187897990 X:24000445-24000467 ATTTTGAGATGGAGTCTCACAGG - Intronic
1188736993 X:33728804-33728826 TTTTTGAGATGGAGTGGCCCAGG - Intergenic
1188847628 X:35092810-35092832 TTTTTGAGAAGGAGTCTCACTGG - Intergenic
1189408658 X:40749501-40749523 TTATAGAGATGGGGTCTCACTGG + Intergenic
1189481802 X:41397786-41397808 TTGTAGAGATGGGGTTGCCCAGG + Intergenic
1190261256 X:48798884-48798906 TTTTTGAGATGGAGTCGCCCAGG + Intergenic
1190531330 X:51380323-51380345 TTTTTGAGACGGAGTCTCCCAGG - Intergenic
1190565826 X:51729545-51729567 GTTTTGAGAGAGAGTCGCCCAGG - Intergenic
1192121665 X:68462326-68462348 TATTAAAGATGGAGTCACTCTGG - Intergenic
1192403446 X:70859988-70860010 ATTTTGAGAGGGAGTCACCCTGG - Intronic
1192888321 X:75361660-75361682 TATTCAAGATGGAGTCGCTCTGG - Intergenic
1193267360 X:79487592-79487614 TTTTTGAGATGAAGTTGCCCAGG - Intergenic
1194001841 X:88439559-88439581 TTTTTGAGATGGAGTCTCCTTGG + Intergenic
1194371808 X:93083095-93083117 TATTTGAGATGGAGTCTCCTGGG + Intergenic
1194812508 X:98403185-98403207 TTTTTGAGATGAAGTTGTCCAGG - Intergenic
1195222431 X:102758486-102758508 TCTTCGAGATGGAGTTGCCCAGG - Intergenic
1195262231 X:103143734-103143756 TGTTTGAGATGGAGTCGCCCAGG - Intergenic
1195278181 X:103302880-103302902 TTGAAGAGATGGGGTTGCCCAGG - Intergenic
1195645945 X:107230655-107230677 CTTTTGAGACGGAGTCGCCCAGG - Intronic
1195922913 X:110001293-110001315 TGTTCAAGATGGAGTCGCTCTGG + Intergenic
1196410533 X:115413801-115413823 TTTCTGAGACAGAGTCGCCCAGG + Intergenic
1196772001 X:119303756-119303778 TTTTTGAGACAGAGTTGCCCAGG + Intergenic
1196809619 X:119618833-119618855 TGTGAGAGATGGAGTTGACCTGG - Intronic
1196824885 X:119733131-119733153 TTTTTGAGATGGATTCACCCAGG - Intergenic
1196866555 X:120076390-120076412 TTTTGGAGAAGGAGTCTCGCTGG - Intronic
1196876544 X:120159891-120159913 TTTTGGAGAAGGAGTCTCGCTGG + Intronic
1196926838 X:120641886-120641908 TTGTAGAGACGAAGTCTCCCTGG + Intergenic
1196928487 X:120657500-120657522 TATTTGAGACAGAGTCGCCCAGG - Intergenic
1197197769 X:123720262-123720284 TTGTAGAGATGGAGTCTTGCTGG - Intronic
1197227854 X:123972294-123972316 TTTTTGAGGTGGAGTCGCCCAGG + Intronic
1197351266 X:125386460-125386482 TATTCAAGATGGAGTCGCTCTGG - Intergenic
1199367211 X:147001014-147001036 TATTCAAGATGGAGTCGCTCTGG + Intergenic
1200667064 Y:6037832-6037854 TTTTTGAGACGGAGTCTCGCTGG - Intergenic
1200679851 Y:6197129-6197151 TATTTGAGATGGAGTCTCCTGGG + Intergenic
1200755835 Y:6989192-6989214 TTTTTGAAATGGAGTCACCCAGG - Intronic
1200806342 Y:7437146-7437168 TTTTCGAGATGGAGTCTGGCTGG - Intergenic
1201255842 Y:12107510-12107532 TATTCAAGATGGAGTCGCCCTGG + Intergenic
1201300900 Y:12504020-12504042 TATTCAAGATGGAGTCGCTCTGG - Intergenic
1201318758 Y:12674457-12674479 TTTTTGAGATTGAGTCTCCCTGG + Intergenic
1202186511 Y:22190662-22190684 TTTTTGAGACGGAGTCTCGCTGG + Intergenic
1202204848 Y:22395734-22395756 TTTTTGAGACGGAGTCTCGCTGG - Intronic
1202597090 Y:26551819-26551841 TTGTAGAGAAGGAGTCTCTCTGG + Intergenic