ID: 1034646572

View in Genome Browser
Species Human (GRCh38)
Location 7:152652977-152652999
Sequence GTGAGCACCCTGTGGTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 187}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034646572_1034646581 22 Left 1034646572 7:152652977-152652999 CCCAGAGACCACAGGGTGCTCAC 0: 1
1: 0
2: 1
3: 18
4: 187
Right 1034646581 7:152653022-152653044 GTTCTGCAGGTGATATGGTTAGG No data
1034646572_1034646580 17 Left 1034646572 7:152652977-152652999 CCCAGAGACCACAGGGTGCTCAC 0: 1
1: 0
2: 1
3: 18
4: 187
Right 1034646580 7:152653017-152653039 CCTCAGTTCTGCAGGTGATATGG 0: 1
1: 0
2: 1
3: 13
4: 170
1034646572_1034646578 9 Left 1034646572 7:152652977-152652999 CCCAGAGACCACAGGGTGCTCAC 0: 1
1: 0
2: 1
3: 18
4: 187
Right 1034646578 7:152653009-152653031 GGTGAGGGCCTCAGTTCTGCAGG 0: 1
1: 0
2: 3
3: 17
4: 232
1034646572_1034646576 -7 Left 1034646572 7:152652977-152652999 CCCAGAGACCACAGGGTGCTCAC 0: 1
1: 0
2: 1
3: 18
4: 187
Right 1034646576 7:152652993-152653015 TGCTCACACTTAGCGTGGTGAGG No data
1034646572_1034646577 -6 Left 1034646572 7:152652977-152652999 CCCAGAGACCACAGGGTGCTCAC 0: 1
1: 0
2: 1
3: 18
4: 187
Right 1034646577 7:152652994-152653016 GCTCACACTTAGCGTGGTGAGGG 0: 1
1: 0
2: 1
3: 10
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034646572 Original CRISPR GTGAGCACCCTGTGGTCTCT GGG (reversed) Intronic
900992075 1:6102675-6102697 GGGAGCACCCGGGGGACTCTGGG + Exonic
903965444 1:27086156-27086178 GTGAGCAACTGGTGGCCTCTAGG - Intergenic
904762622 1:32816983-32817005 GTGAGCCCACTGTGATTTCTGGG + Intronic
904912243 1:33944145-33944167 GTCAGCAAACTGTGGTCTGTGGG - Intronic
908653333 1:66360384-66360406 ATGAGCAGCCAGAGGTCTCTGGG + Intronic
911187629 1:94919306-94919328 GTGAGCTTGCTGTGGTCTTTGGG - Intronic
912575737 1:110671453-110671475 GTGAGCACTCTGTGATCTACTGG - Intergenic
915265808 1:154716778-154716800 GAGAGGACACTGTGGTCTCTGGG + Intronic
919112927 1:193242272-193242294 TGGAGCATCTTGTGGTCTCTAGG + Intronic
919860706 1:201737959-201737981 GTGAGCACAATGAGTTCTCTAGG - Intronic
921179728 1:212622474-212622496 CTGAGCATCCTGTGTTCTCATGG + Intergenic
923028792 1:230230138-230230160 ATGAGCCTCCTGTGGCCTCTTGG - Intronic
923855241 1:237838924-237838946 CTGAGCACCCTTTGGTCTGCTGG + Intergenic
1068097961 10:52515700-52515722 TTGAGCACCCTGACATCTCTAGG + Intergenic
1068587775 10:58819045-58819067 GTCAGCAAACTGTGGTCTGTAGG + Intronic
1070679441 10:78438326-78438348 GTGAGCACCCTCTGGGCTTTGGG + Intergenic
1070837065 10:79454979-79455001 CTGAGGACCCTGTGGTCCCAAGG + Intergenic
1071292887 10:84200443-84200465 GTGAGCACCCAGTGGGGGCTGGG - Intronic
1074467665 10:113697765-113697787 ATGTGCACCCTGTTGTCTGTGGG + Intronic
1074499407 10:114009744-114009766 TTCATCAACCTGTGGTCTCTGGG + Intergenic
1075509881 10:123063509-123063531 GTGTGCACTTTGAGGTCTCTTGG - Intergenic
1076193863 10:128501021-128501043 TTGAGCAACCTCTGCTCTCTCGG + Intergenic
1076221819 10:128739860-128739882 GTGAGCAGCCTGTGATGGCTGGG - Intergenic
1077331774 11:1987138-1987160 GTGAGCACCCAGTGGCCTGGTGG + Intergenic
1077394314 11:2313626-2313648 AGGACCTCCCTGTGGTCTCTCGG + Intronic
1084617564 11:70246572-70246594 GGGAGCAGCCTGTGGTCTCCAGG - Intergenic
1084675183 11:70629969-70629991 ATAAGCACCCTGGGGTCTCCTGG - Intronic
1085526814 11:77168828-77168850 GTGAGCACCTTGGCCTCTCTGGG - Intronic
1087175514 11:95091527-95091549 GGGAACACCCTGTGAGCTCTAGG - Intronic
1087212826 11:95460847-95460869 GTGAGCACACAGTGGGTTCTGGG - Intergenic
1087914179 11:103789429-103789451 GTAAGCACTTTGTGGTTTCTTGG + Intergenic
1089339298 11:117746704-117746726 GGGAGCACCCTAGGGTCCCTGGG - Intronic
1202814755 11_KI270721v1_random:42314-42336 GTGAGCACCCAGTGGCCTGGTGG + Intergenic
1094268939 12:28589951-28589973 GTGATTACCCTATGGTCTGTTGG + Intergenic
1094458611 12:30668241-30668263 GTGAGGATCCTGTTTTCTCTTGG - Intronic
1095077823 12:37953875-37953897 GTGAGCACTTTGAGGCCTCTGGG - Intergenic
1095462108 12:42454378-42454400 GTGGGCACATTTTGGTCTCTTGG - Intronic
1095971391 12:47904244-47904266 GGGAACAGCCTGTGGTCTCCAGG - Intronic
1096609594 12:52792143-52792165 GTGAGTTCCCAGTGGTCACTGGG - Intronic
1101725047 12:107381977-107381999 TTGAGCCCCCTATGGTCTCCAGG + Intronic
1104208919 12:126668408-126668430 GTGAGCAGCCTGAGGTCTGAAGG - Intergenic
1107727255 13:43311296-43311318 ATAAGGACCCTGAGGTCTCTTGG - Intronic
1110342527 13:74409563-74409585 TTGAGCTCCCTGTTGCCTCTGGG - Intergenic
1111987313 13:95078192-95078214 GAGAGAACCCTGTGGACTCGTGG - Intronic
1112872375 13:103990315-103990337 CTCAGCACCCAGAGGTCTCTAGG + Intergenic
1113137953 13:107114599-107114621 GTCAACACCTTGTGGTATCTTGG - Intergenic
1113699809 13:112376045-112376067 CTGAGCACCCTGAGGACTCAAGG - Intergenic
1113898541 13:113782750-113782772 GTGCCCAACCTGTGGTCTCTGGG - Intronic
1113996743 14:16090072-16090094 GTGAGCCCTTTGAGGTCTCTGGG - Intergenic
1117606207 14:57431418-57431440 GAGAGCACCAAGTGGGCTCTTGG + Intergenic
1118324944 14:64774370-64774392 GTGCGCCCCCTGTGGTGACTCGG - Intronic
1119253579 14:73179069-73179091 GTGATCTCCATGTGGTTTCTTGG + Intronic
1120044818 14:79794080-79794102 GTGAGCCACCTGTTCTCTCTAGG - Intronic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122427671 14:101621160-101621182 CTGAGACCCCTGTGGTGTCTGGG + Intergenic
1123075148 14:105664345-105664367 GTGAGCACCTGGTGGTCTGGAGG + Intergenic
1123089795 14:105737473-105737495 GTGAGCACCTTGTGGTCCGGAGG + Intergenic
1125705845 15:41735205-41735227 GTGAGCACCCTGAGGATTATGGG + Intronic
1126175953 15:45735863-45735885 CTGACCACCCTGGGGCCTCTGGG - Intergenic
1128336289 15:66787654-66787676 GTTAGCACCCTGCCCTCTCTGGG - Intergenic
1130512938 15:84604136-84604158 GAGTGCACCCTGTGGTCCCCTGG - Exonic
1131524753 15:93143871-93143893 GTCACCACCATGTGGTCACTGGG + Intergenic
1131992594 15:98105466-98105488 GTGAGGGCCCTGTGGTTTCTGGG - Intergenic
1132098336 15:99005008-99005030 GTGAGGGCCCTGTGGTTTCTGGG + Intronic
1132350981 15:101139597-101139619 CTTAGAACCCTGTGGTCTCCAGG + Intergenic
1132863796 16:2084000-2084022 CTGGGCAGCCTGTGGTCTCAGGG + Intronic
1133236764 16:4391034-4391056 GGGGGCTTCCTGTGGTCTCTGGG - Intronic
1133645621 16:7761763-7761785 GTGAGTATCCTGAGCTCTCTCGG - Intergenic
1134119197 16:11571706-11571728 GAGTGGGCCCTGTGGTCTCTGGG + Intronic
1134228419 16:12410325-12410347 GACAACACCCTGTGGCCTCTAGG - Intronic
1134250002 16:12567809-12567831 CTGAGCACCCTCTGCTCTCACGG + Intronic
1135207103 16:20492859-20492881 CTCAGCACCCTGTGGCCTTTGGG + Intergenic
1135211782 16:20530773-20530795 CTCAGCACCCTGTGGCCTTTGGG - Intergenic
1136106865 16:28036302-28036324 GTGAGGAACCTGTGGCCTTTAGG - Intronic
1137604240 16:49776502-49776524 GTGAGCTCCCAGTGGCCTCTTGG - Intronic
1137715495 16:50595817-50595839 GTGACCACCCTGTGGTGACACGG + Intronic
1138071272 16:53995449-53995471 GTGAGCTCCCGATGGTGTCTGGG - Intronic
1139594966 16:67952087-67952109 GTGCCCACCCTGCAGTCTCTGGG + Intronic
1139953081 16:70681279-70681301 GTGAGCCCCCTGTAGCCTGTAGG - Intronic
1141740269 16:85887062-85887084 ATGACCAACTTGTGGTCTCTGGG + Intergenic
1145211224 17:21014805-21014827 GTGAGTTTCCTGTGGTCTCTGGG - Intronic
1147048270 17:37771027-37771049 GGGAGCACCCTGAGGACCCTAGG - Intergenic
1149971249 17:61220658-61220680 TTGAGTACCCTGTTGTCACTGGG - Intronic
1150226055 17:63524986-63525008 GTGAGGACCCTGTGGTCCTGGGG - Intronic
1151751258 17:76039506-76039528 GAGAGCACCCTGTTGTCTTCTGG - Exonic
1152687544 17:81701952-81701974 GTGAGCTGGCTGTGGTGTCTGGG + Exonic
1155988572 18:32256088-32256110 GTAAGCAACGTGTGCTCTCTTGG + Intronic
1156295222 18:35783394-35783416 TGTAGAACCCTGTGGTCTCTGGG - Intergenic
1159337079 18:67082103-67082125 GTCAGCAACATATGGTCTCTTGG - Intergenic
1159443244 18:68508486-68508508 GTGAGCACCCTGTTATCTAAAGG + Intergenic
1160794526 19:938762-938784 GTGAGGACCCAGCGGTCTCTGGG - Intronic
1161347875 19:3777163-3777185 GTGAGCAACCTGCCCTCTCTGGG + Intergenic
1162663017 19:12185082-12185104 GTCAGCAACATATGGTCTCTTGG + Intronic
1164363384 19:27544491-27544513 GTGAGCCCACTGTAGTCTATGGG + Intergenic
1164667501 19:30051303-30051325 GTGAAGACCCTGGGGTCTCGGGG - Intergenic
926198230 2:10776240-10776262 GTGAGCGCCCTGTGCTATTTCGG - Intronic
926726817 2:16005031-16005053 GTGAGCACCCTTTGGCCTTAGGG + Intergenic
932306871 2:70710179-70710201 GTGAGCCCCCTGTGCTCCCTAGG + Intronic
933393734 2:81705712-81705734 GAGAGCATCATGTGTTCTCTTGG + Intergenic
935342924 2:102074050-102074072 ATGAGCAGCACGTGGTCTCTAGG + Intronic
937454817 2:122032101-122032123 GAGAGCACCCTGGTGGCTCTGGG - Intergenic
938978310 2:136500966-136500988 GTGATCAGGGTGTGGTCTCTGGG - Intergenic
941588051 2:167384383-167384405 GTAAGCATCATGTGCTCTCTCGG + Intergenic
943400495 2:187403701-187403723 GTGAGAAGCTTGAGGTCTCTGGG + Intronic
944226880 2:197357059-197357081 GTGAGACCCCTGTGGACTCCTGG - Intergenic
946278078 2:218645646-218645668 GCGAGCACTCTCTGGGCTCTGGG - Intronic
947472757 2:230413528-230413550 GTGAGCACCAAGTGGTCAATGGG - Intergenic
947866402 2:233400674-233400696 CTGAGCTCCCTGAGCTCTCTCGG + Intronic
947915558 2:233829902-233829924 GGGAGCAGGCTGTGGCCTCTGGG - Intronic
948117256 2:235502477-235502499 GTGGCCACCCTGAGCTCTCTGGG + Intronic
1169174946 20:3502786-3502808 GTGCCCACCCTGGTGTCTCTGGG - Intronic
1170966306 20:21074961-21074983 CTGATCACCCTGTTCTCTCTGGG + Intergenic
1172339575 20:34145535-34145557 GTTGGCACCAGGTGGTCTCTTGG + Intergenic
1172707316 20:36891640-36891662 GTGACCACCCAGTGGGCTCCAGG - Exonic
1174148269 20:48467784-48467806 GTGACCAGGCTGTGGTCACTGGG + Intergenic
1174922463 20:54718349-54718371 GTGAGAACCCTTTGGTGTCTGGG - Intergenic
1179541486 21:42085852-42085874 GAGAGCACCCTGGGGTCTGATGG + Intronic
1179577639 21:42317855-42317877 GTGAGCACCCTGTGACATGTAGG - Intergenic
1179914130 21:44465246-44465268 GTGAGCTCCCTGTGGTCACTAGG - Intergenic
1180310180 22:11217204-11217226 GTGAGCCCTTTGAGGTCTCTGGG + Intergenic
1181630398 22:24148148-24148170 GTGAGCACCCAGTGCTCTGTGGG - Intronic
1183236740 22:36624421-36624443 GTGAGCAGCCTGACCTCTCTGGG - Intronic
1183334071 22:37236743-37236765 ATGCGTGCCCTGTGGTCTCTGGG - Intronic
949928515 3:9060208-9060230 GTGAGCTCCCTGGGGAGTCTGGG - Intronic
953686757 3:45083959-45083981 GTGAGCACACATTGGTCTCATGG + Exonic
953903940 3:46858817-46858839 GGGAGCAGCGGGTGGTCTCTTGG - Intronic
955090396 3:55744610-55744632 GTGAGCACCAAGTGGTCAATGGG + Intronic
956663622 3:71622070-71622092 TTCAGGAGCCTGTGGTCTCTTGG - Intergenic
961171604 3:124801457-124801479 GTGACAACCCTGTGTGCTCTGGG - Intronic
962313892 3:134345921-134345943 GGGAGCACCTTGTGCTCTTTGGG + Intergenic
964592350 3:158378766-158378788 GAGAAAACCCTGTGGTCTTTTGG - Intronic
966320867 3:178699619-178699641 CTGAGCACCCCTTGGTCTCCTGG - Intronic
968543168 4:1178515-1178537 GTGAGCAGCCAGGGGTGTCTTGG - Intronic
968621286 4:1604499-1604521 GGGGGCTCCCTGGGGTCTCTCGG - Intergenic
968909558 4:3470636-3470658 GTCGGCTCACTGTGGTCTCTGGG + Intronic
972114874 4:35619387-35619409 ATGAGAATCCTGTGGTCTTTGGG + Intergenic
973576137 4:52291209-52291231 GTGAGCTCTCTGGAGTCTCTTGG + Intergenic
978688872 4:111483309-111483331 CTGAGCACCCCTTGGTCTCCTGG + Intergenic
980103771 4:128567346-128567368 GGGGGCAGCCTGTTGTCTCTGGG - Intergenic
982598954 4:157421175-157421197 GGGAGGACCTTGTGGTCTCCTGG + Intergenic
985384309 4:189429318-189429340 GTGAGAACCCTGTGTCCGCTTGG - Intergenic
986597638 5:9440054-9440076 GTGAGCACCCTGTCTTCCCCAGG - Intronic
986899356 5:12412881-12412903 TAGAGCACCATGTGGGCTCTTGG - Intergenic
989419453 5:41219412-41219434 TTGAGCGCCCTTTGTTCTCTGGG + Intronic
990281946 5:54260558-54260580 ACTAGAACCCTGTGGTCTCTTGG - Intronic
990813290 5:59753057-59753079 TTGCGGACCCTATGGTCTCTGGG - Intronic
992393471 5:76350531-76350553 GTCAGCAACCTGCTGTCTCTAGG - Intronic
995150435 5:108838292-108838314 GTAAGCACCCCGCAGTCTCTAGG - Intronic
995479194 5:112578268-112578290 GTTAGCTCCCTGGGATCTCTTGG - Intergenic
995973089 5:117997062-117997084 GTGAGCATCCTGTGAGGTCTGGG - Intergenic
997065572 5:130555407-130555429 GTTAGCAACTAGTGGTCTCTGGG - Intergenic
997203524 5:132027146-132027168 ATGAGCACCCTTCGGGCTCTGGG + Intergenic
997836573 5:137199170-137199192 GGCAGCACCCTGTGTTCTCCTGG - Intronic
997870117 5:137499042-137499064 TTGAGCGCCCTGAGGTCTCGGGG + Intronic
999443284 5:151619591-151619613 GTGTGGAACCAGTGGTCTCTTGG - Intergenic
1001711037 5:173778134-173778156 GTTAGGGCCCTGGGGTCTCTGGG + Intergenic
1002472895 5:179447759-179447781 GTGTGCAGCCTCTGGTCTCGAGG + Intergenic
1002481327 5:179502903-179502925 GTGTGCAGCCTCTGGTCTCGAGG - Intergenic
1004269096 6:14177931-14177953 GTGAGCAATCTGAGTTCTCTTGG - Intergenic
1006045038 6:31288005-31288027 GGGAGCATCCTGTAGTCTCCTGG + Intronic
1006269107 6:32950353-32950375 GTCTGCACCCTGTGTTCTTTTGG - Intronic
1006744516 6:36331906-36331928 GACGGCCCCCTGTGGTCTCTAGG + Intronic
1008917342 6:56802734-56802756 AGGAGCACCATGTGGCCTCTTGG + Intronic
1009925818 6:70119484-70119506 GTGATCACCCAGTATTCTCTAGG + Intronic
1012906133 6:105068546-105068568 GGGATCAGCCTGTGGTCTCATGG - Intronic
1012972279 6:105743994-105744016 GGGGGCATCCTGTGATCTCTAGG + Intergenic
1013692702 6:112665323-112665345 GTCAGCACCCTAGGATCTCTGGG + Intergenic
1015030319 6:128586808-128586830 TAGAGCACCAAGTGGTCTCTTGG + Intergenic
1017044898 6:150338041-150338063 CTGACCACCCTGGGTTCTCTAGG - Intergenic
1017554516 6:155548435-155548457 GTGCGTACCCTGTGGTTTCAAGG - Intergenic
1019334596 7:477015-477037 CTGAGCACCCTGTTTTCTGTCGG + Intergenic
1022022317 7:26412659-26412681 CTGTGCAAACTGTGGTCTCTGGG + Intergenic
1023733212 7:43211419-43211441 GCGGGCACCCTGTGGACGCTAGG + Intronic
1023885161 7:44349055-44349077 GTGAACACCCTTATGTCTCTGGG - Intergenic
1032489553 7:132313963-132313985 GTGAGCCCTCTGTAGTGTCTGGG - Intronic
1034646572 7:152652977-152652999 GTGAGCACCCTGTGGTCTCTGGG - Intronic
1035097778 7:156369547-156369569 CTGAGCACCCTGTGTACTTTGGG - Intergenic
1035099683 7:156386293-156386315 GGGAGCATCTTGGGGTCTCTGGG + Intergenic
1038447191 8:27612220-27612242 ATGAGCATGCTGTGGACTCTAGG - Intronic
1039478545 8:37854897-37854919 GCAGGCAGCCTGTGGTCTCTGGG + Intergenic
1039900927 8:41752054-41752076 GAGAGCGCCATGTGGTTTCTGGG - Intronic
1040284392 8:46092528-46092550 AAGAGCACCCTGTGGTCTGCTGG - Intergenic
1040328816 8:46375624-46375646 GGGAGCACCCTGTGGTTTTCTGG + Intergenic
1040603718 8:48909769-48909791 GTGAGCAACCCATGGCCTCTGGG + Intergenic
1040688116 8:49901151-49901173 AGGAGCAGCATGTGGTCTCTCGG + Intergenic
1040755263 8:50765454-50765476 GTGAGGGTCCTGGGGTCTCTGGG + Intronic
1045057137 8:98378943-98378965 CTGAGAACCCTGTGGTGTTTGGG + Intergenic
1045187681 8:99855400-99855422 GTGGGAACCATGTGGTCTCAGGG + Intronic
1045429108 8:102096693-102096715 GTGAGCACCAAGTGGTCAATGGG + Intronic
1045531724 8:102991366-102991388 GTGAGCACAGTGTGGTCTGTGGG + Intergenic
1049757500 8:144317260-144317282 CTGATCCCCCTGTGGTCTCTTGG - Intronic
1049771951 8:144386990-144387012 GTCAGCAAACTGTGGTCCCTGGG + Intronic
1052286082 9:26787243-26787265 GTGATCTCCCTGTACTCTCTAGG - Intergenic
1056650048 9:88451457-88451479 CTGAGCACCTTGTGGTGTTTTGG + Intronic
1061208986 9:129179782-129179804 TAGCCCACCCTGTGGTCTCTGGG + Intergenic
1185959629 X:4534865-4534887 GTGATCACCCTGCGTTATCTGGG - Intergenic
1188972301 X:36632771-36632793 AAGAGCACCAAGTGGTCTCTAGG - Intergenic
1189097157 X:38152430-38152452 GTCCTCACCATGTGGTCTCTTGG + Intronic
1189558199 X:42166438-42166460 GTGAGCACCCCTTGGTCTGCTGG - Intergenic
1189940707 X:46117740-46117762 GTGAGCACCCCTTGGTCTGCTGG - Intergenic
1190430259 X:50371925-50371947 GTTGGCACCTTGTGGTCTCTTGG - Intronic
1190628669 X:52363633-52363655 GTCAGCAACCTATGGGCTCTTGG - Intergenic
1196749985 X:119107399-119107421 GTGAGAACCCTGTTGCCACTTGG + Intronic
1197727123 X:129783728-129783750 CTGAGCACCCTGTGAGCTCTAGG - Intronic
1200243226 X:154508451-154508473 GTGAGCTCCCTGGGGTGACTGGG - Intronic
1200253437 X:154566228-154566250 GTGACCACCTTGTGGTCTGTGGG + Intergenic
1200264330 X:154638180-154638202 GTGACCACCTTGTGGTCTGTGGG - Intergenic