ID: 1034647899

View in Genome Browser
Species Human (GRCh38)
Location 7:152664761-152664783
Sequence GGCCACCTGGACATTCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 247}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034647899_1034647908 15 Left 1034647899 7:152664761-152664783 CCCCAAGGAATGTCCAGGTGGCC 0: 1
1: 0
2: 0
3: 23
4: 247
Right 1034647908 7:152664799-152664821 ACTGGTTGCAGCTGGCACCAGGG No data
1034647899_1034647911 20 Left 1034647899 7:152664761-152664783 CCCCAAGGAATGTCCAGGTGGCC 0: 1
1: 0
2: 0
3: 23
4: 247
Right 1034647911 7:152664804-152664826 TTGCAGCTGGCACCAGGGAGGGG No data
1034647899_1034647910 19 Left 1034647899 7:152664761-152664783 CCCCAAGGAATGTCCAGGTGGCC 0: 1
1: 0
2: 0
3: 23
4: 247
Right 1034647910 7:152664803-152664825 GTTGCAGCTGGCACCAGGGAGGG 0: 1
1: 1
2: 8
3: 33
4: 315
1034647899_1034647904 -3 Left 1034647899 7:152664761-152664783 CCCCAAGGAATGTCCAGGTGGCC 0: 1
1: 0
2: 0
3: 23
4: 247
Right 1034647904 7:152664781-152664803 GCCTCTTCAGGAATGATAACTGG 0: 1
1: 0
2: 2
3: 7
4: 95
1034647899_1034647906 7 Left 1034647899 7:152664761-152664783 CCCCAAGGAATGTCCAGGTGGCC 0: 1
1: 0
2: 0
3: 23
4: 247
Right 1034647906 7:152664791-152664813 GAATGATAACTGGTTGCAGCTGG 0: 1
1: 0
2: 10
3: 54
4: 197
1034647899_1034647909 18 Left 1034647899 7:152664761-152664783 CCCCAAGGAATGTCCAGGTGGCC 0: 1
1: 0
2: 0
3: 23
4: 247
Right 1034647909 7:152664802-152664824 GGTTGCAGCTGGCACCAGGGAGG 0: 1
1: 0
2: 2
3: 35
4: 303
1034647899_1034647907 14 Left 1034647899 7:152664761-152664783 CCCCAAGGAATGTCCAGGTGGCC 0: 1
1: 0
2: 0
3: 23
4: 247
Right 1034647907 7:152664798-152664820 AACTGGTTGCAGCTGGCACCAGG 0: 1
1: 12
2: 37
3: 111
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034647899 Original CRISPR GGCCACCTGGACATTCCTTG GGG (reversed) Intronic
900829834 1:4958125-4958147 GGCCCCCAGGAACTTCCTTGTGG + Intergenic
901460706 1:9389619-9389641 GTCCACAAGGAAATTCCTTGTGG + Intergenic
902845142 1:19104556-19104578 AGCCACCTGGACCTTCCTTTAGG - Intronic
906130254 1:43451528-43451550 TGCCACCTGCACATGCCCTGGGG + Exonic
906836216 1:49085851-49085873 AGCCACCTGGACATTTTGTGGGG + Intronic
910125205 1:83833081-83833103 GAACACCTGGACATTGCTAGTGG - Intergenic
912531713 1:110328982-110329004 GTCCACAGGGAAATTCCTTGCGG - Intergenic
915219383 1:154362080-154362102 GTCCACAAGGAAATTCCTTGCGG + Intergenic
918298230 1:183177934-183177956 GCCCACTAGGAAATTCCTTGTGG - Intergenic
918481698 1:184985006-184985028 GGACACCTGAAAATTCCTTCTGG - Intergenic
919931929 1:202226672-202226694 CCTCACCTGGACATTCCCTGGGG - Intronic
919980155 1:202637884-202637906 GGCCACAGTGACATTCCTGGAGG - Intronic
922473582 1:225890975-225890997 GGACACCTGGACTGGCCTTGGGG - Intronic
923536077 1:234852902-234852924 GCCCACCAGGAAATTCCTTGTGG - Intergenic
1063130882 10:3175220-3175242 GTCCACAAGGAAATTCCTTGTGG - Intergenic
1064628727 10:17287271-17287293 GCCCACAAGGAAATTCCTTGTGG + Intergenic
1067541638 10:47159306-47159328 GCCCATCTGGGCATTCCCTGTGG - Intergenic
1067728906 10:48794799-48794821 GGCCACCTGGAAGTCCCTGGTGG + Intronic
1069273695 10:66563685-66563707 GCCCACAAGGAAATTCCTTGTGG + Intronic
1070544651 10:77442796-77442818 GGCCACCTGGTCATTCCTCTTGG - Intronic
1070821381 10:79357264-79357286 AGCCAGCTGGACATCCCTTGGGG + Intergenic
1072357133 10:94622924-94622946 GCCCACAAGGAAATTCCTTGTGG - Intergenic
1073518915 10:104106696-104106718 GCCCACTAGGAAATTCCTTGTGG - Intergenic
1073849535 10:107598886-107598908 GGTCACCTGAACATTTCTGGGGG - Intergenic
1075120169 10:119659064-119659086 GGCCACCTGGACACTGGTCGGGG - Intronic
1076104336 10:127808673-127808695 GCCCACAAGGAAATTCCTTGTGG + Intergenic
1078290343 11:10004631-10004653 GCCCACAAGGAAATTCCTTGTGG + Intronic
1079354653 11:19720121-19720143 GGGCAGCTGGCCATGCCTTGGGG - Intronic
1081539266 11:44018179-44018201 GGCCACCTGGGCAGTACTTAAGG + Intergenic
1083870580 11:65485674-65485696 GCCCACAAGGAAATTCCTTGTGG - Intergenic
1088350009 11:108875607-108875629 GGACACCTGGTCATTTGTTGTGG - Intronic
1088353284 11:108913514-108913536 GCCCACAAGGATATTCCTTGTGG - Intronic
1089835820 11:121369743-121369765 GCCCACAGGGAAATTCCTTGTGG - Intergenic
1089836442 11:121374580-121374602 GCCCACAAGGAAATTCCTTGTGG - Intergenic
1090456362 11:126852905-126852927 TGCTCCCTGGACATTCCCTGAGG - Intronic
1090808088 11:130215407-130215429 GGCCACCGGGCCATTCCTCAGGG + Intergenic
1091242302 11:134061830-134061852 GCCCACAAGGAAATTCCTTGTGG + Intergenic
1091618440 12:2067337-2067359 GGCCAGGTGGACTTTCTTTGGGG + Intronic
1092363798 12:7860384-7860406 GTCCTCCTGGCCATTCCTTTAGG + Intronic
1092380755 12:7995117-7995139 GTCCTCTTGGCCATTCCTTGAGG - Intergenic
1094742638 12:33307330-33307352 GCCCACAAGGAAATTCCTTGTGG + Intergenic
1094745834 12:33343265-33343287 GGCCACAAGGAATTTCCTTGTGG + Intergenic
1095979131 12:47960904-47960926 GTCCACAAGGAAATTCCTTGTGG + Intergenic
1101901582 12:108794757-108794779 GCCCACAAGGAAATTCCTTGCGG + Intronic
1103198583 12:119068036-119068058 CCCCACTTGGACATTCCTAGTGG - Intronic
1103489003 12:121302395-121302417 GGCCGCCAGGAATTTCCTTGTGG - Intergenic
1104812161 12:131626023-131626045 GGGCTCCTGTACCTTCCTTGGGG + Intergenic
1106179976 13:27362166-27362188 GGCCAGCGGGTCATGCCTTGGGG - Intergenic
1106364050 13:29060251-29060273 AGCCACCTGGACATTTTGTGGGG - Intronic
1109960434 13:69621839-69621861 GCCCACAAGGAAATTCCTTGTGG + Intergenic
1110303692 13:73959042-73959064 CTCCAACTGGACATTCCATGGGG + Intronic
1111034751 13:82657703-82657725 GCCCACAAGGAAATTCCTTGTGG - Intergenic
1112679234 13:101742816-101742838 GTCCACAAGGAAATTCCTTGTGG + Intronic
1113540094 13:111100534-111100556 AGCCACCTGGACATTTTGTGGGG + Intergenic
1114538528 14:23438125-23438147 GCACACATGCACATTCCTTGTGG + Intergenic
1116354778 14:43914542-43914564 GCACTCCTAGACATTCCTTGGGG + Intergenic
1116799592 14:49429166-49429188 GGCCACCTGGACATTTTTGGGGG + Intergenic
1117080873 14:52150799-52150821 AGCCACCTGGACATTCTGCGGGG - Intergenic
1117094119 14:52280510-52280532 GTCCACACGGAAATTCCTTGGGG + Intergenic
1118197995 14:63646008-63646030 TGCCACAAGGAAATTCCTTGTGG + Intergenic
1118577425 14:67257317-67257339 GCCCACAAGGAAATTCCTTGTGG - Intronic
1119491370 14:75036640-75036662 GGCCACCTTGACATCTCTTCTGG + Intronic
1120475106 14:84977158-84977180 GACAACCTGGACATTACTTAAGG - Intergenic
1120769757 14:88366160-88366182 GTCCACTGGGAAATTCCTTGTGG - Intergenic
1122918444 14:104869473-104869495 GGCCATGTGCACATTCCCTGGGG + Intronic
1123883343 15:24696564-24696586 GCCCACAAGAACATTCCTTGTGG - Intergenic
1124495768 15:30185929-30185951 GGCCACAGTGACATTCCTGGAGG - Intergenic
1124747805 15:32352717-32352739 GGCCACAGTGACATTCCTGGAGG + Intergenic
1125043779 15:35222850-35222872 GCCCACAAGGAAATTCCTTGTGG - Intronic
1127884706 15:63189354-63189376 AGCCGCCTGGACAGTCCTCGCGG + Intergenic
1130127140 15:81103540-81103562 GACCACCTGGAGGTTCCTGGAGG + Intronic
1130131492 15:81146914-81146936 GCCCACAAGGAAATTCCTTGTGG + Intronic
1131008502 15:88998029-88998051 GCCCACAAGGAAATTCCTTGTGG + Intergenic
1131496491 15:92915875-92915897 GCCCACAGGGAAATTCCTTGTGG + Intronic
1132297308 15:100749335-100749357 GCCCACATGAAAATTCCTTGTGG - Intergenic
1132590518 16:724449-724471 GGCCCTCCGGACATTCCTGGAGG - Exonic
1134280566 16:12813409-12813431 GCCCACAAGGAAATTCCTTGTGG + Intergenic
1134369538 16:13610185-13610207 GTCCACAAGGAAATTCCTTGTGG + Intergenic
1135195785 16:20393468-20393490 ACCCAATTGGACATTCCTTGTGG + Intronic
1136573865 16:31111981-31112003 GGCCATCTGGACATGCATAGTGG + Exonic
1138351502 16:56348444-56348466 GGCCACCTGGACACTGCTGTGGG + Intronic
1143970744 17:10793498-10793520 GGCCACCTAGACAGTGCATGTGG - Intergenic
1144089498 17:11841699-11841721 GCCCACAAGGAAATTCCTTGTGG - Intronic
1144174799 17:12694627-12694649 GGCAACCTGGTCATACTTTGTGG + Intronic
1144673611 17:17146898-17146920 GGCCACATGGCCATGGCTTGCGG + Intronic
1149948770 17:60961374-60961396 TTCCACCTGGACATTCCTTCTGG - Intronic
1151982570 17:77522172-77522194 GCCCACAAGGAAATTCCTTGTGG + Intergenic
1153526208 18:5997355-5997377 GCCCATCAGGAAATTCCTTGTGG + Intronic
1154148195 18:11884111-11884133 GGCCACCAGGCCCTTCCTGGGGG + Exonic
1156268280 18:35508119-35508141 GCCCTCCTGGCCATTCCCTGTGG + Intergenic
1161200230 19:3010540-3010562 TGCCACCTGGGAGTTCCTTGAGG + Intronic
1162495138 19:11019314-11019336 CGCCATCTGCACATTCCTGGTGG - Intronic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1163655919 19:18544654-18544676 GGGCACCTGGTCTTGCCTTGGGG - Intergenic
1164432014 19:28197114-28197136 GCACAGCTGGTCATTCCTTGAGG - Intergenic
1164857402 19:31535795-31535817 GGCTACCTGGACAGACCCTGGGG + Intergenic
1164899104 19:31903172-31903194 TGCCACCAGGGCATTCCTGGTGG + Intergenic
1166512721 19:43420560-43420582 GGCCACAAGGAAATTCCTTGTGG + Intergenic
1167876143 19:52414306-52414328 TGCCACCTGCACAGACCTTGGGG + Intronic
925188646 2:1866118-1866140 GGCGGCCTGGAGATGCCTTGTGG + Intronic
925644496 2:6022031-6022053 GGCCACCAGGAATTTCCCTGTGG + Intergenic
926250146 2:11150810-11150832 GCCCACAAGGAAATTCCTTGTGG + Intergenic
929386199 2:41410071-41410093 GCCCACCTGGCCATTTTTTGGGG - Intergenic
930082631 2:47465936-47465958 GCCCACAAGGACTTTCCTTGTGG + Intronic
932727619 2:74193130-74193152 GCCCACAAGGAAATTCCTTGTGG - Intergenic
932874698 2:75438844-75438866 GGCAACCTGAAGGTTCCTTGTGG + Intergenic
934888210 2:98043123-98043145 GCCCACATGGGAATTCCTTGTGG + Intergenic
935160508 2:100525748-100525770 GCCCACTAGGAAATTCCTTGTGG + Intergenic
935221668 2:101020683-101020705 ATGCACCTGGACATTACTTGTGG - Intronic
935226826 2:101060065-101060087 GGCCACCTGGCCCATCTTTGTGG - Intronic
935894576 2:107720654-107720676 GGCAAGCTGGACATGCCTTCTGG + Intergenic
937963090 2:127478252-127478274 GGACACATGGACAAACCTTGAGG + Intronic
938685423 2:133733186-133733208 GGCCACCTAGACATTTCATTGGG - Intergenic
939614434 2:144346699-144346721 GCCCACAAGGAAATTCCTTGTGG + Intergenic
940396506 2:153197118-153197140 TGGCATCTGGACATTCCTTCTGG - Intergenic
942316197 2:174698606-174698628 GCCCACATGGAATTTCCTTGTGG - Intergenic
942990887 2:182201308-182201330 GGCCACCTACACATTCTTGGGGG - Intronic
943598223 2:189882763-189882785 GCCCACAAGGAAATTCCTTGTGG - Intronic
944915570 2:204357302-204357324 GGCAACCTGGCCCTTCCTTCAGG - Intergenic
946241940 2:218361647-218361669 GCCCACAAGGAAATTCCTTGTGG - Intronic
946404614 2:219485566-219485588 GGCCACCTTGACAAACCTAGTGG + Intronic
948086732 2:235256734-235256756 GCCCACAAGGAAATTCCTTGTGG - Intergenic
948352748 2:237354358-237354380 GCCCACAGGGAAATTCCTTGTGG + Intronic
1168843470 20:925145-925167 GGCCAACTGGACTTTGCTTCTGG - Intergenic
1170622523 20:18007730-18007752 GGCCACATAGACAGGCCTTGTGG - Intronic
1172002186 20:31787924-31787946 GCCCACTTGAAAATTCCTTGGGG - Intronic
1172244628 20:33437585-33437607 GGCCTCTTGGACACTCCTTTAGG + Intronic
1174337251 20:49871742-49871764 GGCCATCTGGACAATCCCAGAGG - Intronic
1174661042 20:52213472-52213494 GCCCACAAGGAAATTCCTTGTGG - Intergenic
1175058437 20:56219438-56219460 GCCCACCAGGAAATTCCTTATGG - Intergenic
1175505076 20:59476852-59476874 GCCCACAAGGAAATTCCTTGTGG + Intergenic
1176068649 20:63214756-63214778 GTCCACCAGGAATTTCCTTGTGG + Intronic
1176996295 21:15559239-15559261 GCCCACTAGGAAATTCCTTGTGG - Intergenic
1177570583 21:22881058-22881080 GCCCACCAGGAAATTCCTTGTGG + Intergenic
1179337136 21:40467974-40467996 GCCCACTAGGAAATTCCTTGCGG + Intronic
1179892330 21:44342427-44342449 GCCCACAAGGAAATTCCTTGTGG - Intergenic
1179908810 21:44437448-44437470 GGCCACCTGGGCTCCCCTTGTGG + Intronic
1180722686 22:17921024-17921046 GCCCACAAGGAAATTCCTTGTGG + Intronic
1180967686 22:19799101-19799123 GGACACCTGGCCATGTCTTGTGG + Intronic
1182693953 22:32183788-32183810 GGCCATCTGGACTTCCTTTGGGG + Intergenic
1183607798 22:38876606-38876628 GCCCACATGGAAATTCCTTGGGG + Intergenic
1184585347 22:45444229-45444251 GCCCACAAGGAAATTCCTTGTGG - Intergenic
1184807604 22:46805609-46805631 GGCCACATGGCCACTCCTGGTGG + Intronic
1184951440 22:47845347-47845369 GGCCACCAGGAATTTCCTTCTGG + Intergenic
1185120770 22:48968632-48968654 TGCCACCTGGACATTCCCAAAGG + Intergenic
1185416714 22:50714703-50714725 GGTCACCTGGAGTCTCCTTGAGG + Intergenic
949735798 3:7170311-7170333 GGCCACTTGTACATGGCTTGGGG - Intronic
949798568 3:7878177-7878199 AGCCATCTGGACATTCTGTGAGG + Intergenic
957243657 3:77691049-77691071 TGCTAGCTGAACATTCCTTGGGG + Intergenic
958038098 3:88193451-88193473 GTCCACAAGGAAATTCCTTGTGG - Intergenic
960006176 3:112783400-112783422 GTCCACAAGGAAATTCCTTGCGG + Intronic
961317565 3:126050914-126050936 GGACACCTGGACATTCGAGGCGG - Intronic
961358238 3:126352176-126352198 GGCAACCTTGACATTCTCTGGGG + Exonic
963071356 3:141308036-141308058 GGCCACATGCACCTCCCTTGGGG + Intergenic
964773683 3:160252708-160252730 GCCCACAAGGAAATTCCTTGTGG - Intronic
967162903 3:186754996-186755018 GCCCACCAGGAAATTCCCTGTGG + Intergenic
967254297 3:187574004-187574026 GGCCACCTGGATCAGCCTTGGGG + Intergenic
969030413 4:4208224-4208246 GTCCACTAGGAAATTCCTTGTGG - Intronic
969101490 4:4772139-4772161 GGACCCCTGGACATTCTCTGAGG + Intergenic
969847105 4:9927946-9927968 AGCCACCTGTATATTCATTGGGG - Intronic
971006785 4:22383170-22383192 GCCCACCAGGAAGTTCCTTGTGG - Intronic
971328796 4:25665464-25665486 GGCCTCCTGAACATTGCTTCTGG + Intronic
973705178 4:53573833-53573855 GACCCCCTGGACACTCCGTGTGG - Exonic
973723233 4:53746411-53746433 GCCCACAAGGAAATTCCTTGTGG - Intronic
974781219 4:66556191-66556213 GCCCACAAGGAAATTCCTTGTGG + Intergenic
977402751 4:96554699-96554721 GGCTACCTGAACATTGCCTGTGG + Intergenic
980121609 4:128733796-128733818 GCCCACAAGGAAATTCCTTGTGG - Intergenic
981039822 4:140212783-140212805 GCCCACAAGGAAATTCCTTGAGG + Intergenic
981477329 4:145200026-145200048 GCCCACAAGGAAATTCCTTGTGG - Intergenic
981643561 4:146972939-146972961 GAACACCTGGAGATTCCTGGAGG - Intergenic
981725525 4:147843354-147843376 CCCCACCTGGTCATTCTTTGAGG + Intronic
983053992 4:163080833-163080855 GCCCACATGGAAATTCCTTGTGG + Intergenic
983257956 4:165423175-165423197 GTCCACAGGGACATTTCTTGAGG - Intronic
983376493 4:166935154-166935176 GGCCACCTGTACTTTCCCTTGGG + Intronic
983583712 4:169334303-169334325 GGCCACAAGGAAATTCCTTCTGG + Intergenic
984600264 4:181718754-181718776 GGCCCTCTGGACATTCCTGAAGG + Intergenic
985395249 4:189536983-189537005 GGCCACATGGAGGTTCCTGGAGG - Intergenic
986098565 5:4584508-4584530 GCCCACCAGGAAATTCCTTGTGG - Intergenic
986104122 5:4643658-4643680 GGACAGCTGGAAATTCCTTGGGG + Intergenic
986505461 5:8445415-8445437 GCCCACTTGGAAATTCCTTGTGG - Intergenic
987679867 5:21121404-21121426 AGCCACCTTGACATTCAGTGTGG + Intergenic
989168785 5:38455241-38455263 GGCCACCCGGAAATACCTTCAGG - Intronic
989266598 5:39481872-39481894 GACCACCTGGAGAATCCTTAAGG - Intergenic
989411345 5:41122827-41122849 AGCCCCCGGGACATTCTTTGGGG + Intergenic
990371080 5:55119067-55119089 GGCCTCCTGGCCAATCCCTGAGG - Intronic
994141874 5:96350528-96350550 GCCCACTAGGAAATTCCTTGTGG - Intergenic
994908674 5:105873240-105873262 GTCCACATGGAATTTCCTTGTGG + Intergenic
996939675 5:128989624-128989646 GGCCACCTCAACATATCTTGAGG - Intronic
997523586 5:134538673-134538695 GGACACCTGGACCCTCCTTCTGG + Intronic
999726368 5:154441629-154441651 GCCCACAAGGAAATTCCTTGTGG + Intergenic
1000365060 5:160482899-160482921 GCCCACTAGGAAATTCCTTGTGG + Intergenic
1003475192 6:6475247-6475269 GCCCACAAGGAAATTCCTTGTGG - Intergenic
1004901389 6:20197390-20197412 GCCCACCAGGAAATTCCTTGTGG + Intronic
1005615456 6:27568217-27568239 GCCCACAAGGAAATTCCTTGTGG + Intergenic
1005624276 6:27648727-27648749 GCCCACAAGGAAATTCCTTGTGG + Intergenic
1005846941 6:29789174-29789196 AGCCACATGGACCTTCCTTCAGG - Intergenic
1006392598 6:33767413-33767435 GCCCAGCTGGAGATGCCTTGTGG - Intergenic
1006965691 6:37982162-37982184 GCCCACAAGGAAATTCCTTGTGG - Intronic
1008091329 6:47296708-47296730 GAACACCTGGAGATTCCTGGAGG + Intronic
1010433918 6:75809101-75809123 GCCCACATGGAAATTCCTTGTGG - Intronic
1012166688 6:95962911-95962933 GCCCACAAGGAAATTCCTTGTGG - Intergenic
1012572203 6:100742929-100742951 GTCCACCTGGACATTCCCCTAGG - Intronic
1013112829 6:107078250-107078272 GCCCTCCTGCACTTTCCTTGGGG + Intronic
1014726902 6:124982059-124982081 GCCCACAAGGAAATTCCTTGTGG - Intronic
1017042623 6:150319715-150319737 GCCCACCAGGAAATTCCTTATGG - Intergenic
1019099811 6:169620355-169620377 GCCCACAAGGAAATTCCTTGTGG + Intronic
1019233321 6:170586633-170586655 GCCCACAAGGAAATTCCTTGTGG - Intergenic
1022590121 7:31653574-31653596 GCCCACTGGGAAATTCCTTGTGG - Intronic
1023216352 7:37867248-37867270 GTCCACAAGGAAATTCCTTGTGG - Intronic
1023786036 7:43708632-43708654 GGCCACTTGGATATTCTTTTTGG + Intronic
1027150889 7:75732907-75732929 GGGCTCCTGGACAAGCCTTGGGG - Intronic
1027675646 7:81154576-81154598 GCCCACTAGGAAATTCCTTGTGG + Intergenic
1029013111 7:97283333-97283355 CGTCACCTGGACTTTCTTTGTGG + Intergenic
1034647899 7:152664761-152664783 GGCCACCTGGACATTCCTTGGGG - Intronic
1035741094 8:1929460-1929482 GGCCTCCTGGCCGGTCCTTGGGG + Intronic
1036177727 8:6555277-6555299 GGCCACATGGAACTTCCCTGAGG + Intronic
1037634965 8:20693344-20693366 GGCCACTTACACACTCCTTGGGG - Intergenic
1038683065 8:29687940-29687962 GACCACCTGGAGAGGCCTTGTGG - Intergenic
1038717646 8:30006210-30006232 GCCCACAAGGAAATTCCTTGTGG + Intergenic
1038726928 8:30089893-30089915 GCCCACAAGGATATTCCTTGTGG + Intergenic
1039690173 8:39855308-39855330 GCCCACAAGGACTTTCCTTGTGG - Intergenic
1040890412 8:52311198-52311220 GGGCAACTGGACATTCCTGCGGG + Intronic
1040997811 8:53419598-53419620 GCCCACAAGGAAATTCCTTGTGG - Intergenic
1041389562 8:57336706-57336728 GGCCTCCTGGGCATTCTTTCAGG + Intergenic
1043577331 8:81673088-81673110 GCCCACAAGGAAATTCCTTGTGG + Intronic
1044057392 8:87588096-87588118 GTCCAGATGGAAATTCCTTGTGG + Intronic
1047110974 8:121789256-121789278 GCCCACAAGGAAATTCCTTGTGG + Intergenic
1049933081 9:474817-474839 GGCCATCTAGACTTTCCCTGAGG + Intronic
1051066300 9:13107575-13107597 AGCCACCTGAACATTCCCTATGG + Intronic
1051629946 9:19131708-19131730 GCCCACTAGGAAATTCCTTGTGG + Intronic
1051669333 9:19494444-19494466 AGCCACCTGGGCATCCTTTGTGG + Intergenic
1052095076 9:24373892-24373914 GCCCACAGGGAAATTCCTTGTGG - Intergenic
1052183571 9:25562311-25562333 GCCCACAAGGAAATTCCTTGTGG - Intergenic
1052190397 9:25654775-25654797 GTCCACAAGGAAATTCCTTGTGG - Intergenic
1052960471 9:34291964-34291986 GCCCACTAGGAAATTCCTTGTGG + Intronic
1055054472 9:72011073-72011095 TCCCACATGGAAATTCCTTGTGG - Intergenic
1055998934 9:82193688-82193710 GGCCAGCTGGCCATGCCGTGCGG - Intergenic
1056074996 9:83029347-83029369 AGCCACATGGACACACCTTGGGG - Intronic
1056749176 9:89334203-89334225 TGCCACGTGGACATTTATTGTGG + Intronic
1057703483 9:97380989-97381011 GGCCACATGGAGATTCCTGGAGG + Intergenic
1057703757 9:97383501-97383523 GGCCACATGGAGATTCCTGGAGG + Intergenic
1057871213 9:98719272-98719294 GGCCATCTGGACTTCCTTTGGGG + Intergenic
1060406221 9:123374312-123374334 CAACGCCTGGACATTCCTTGAGG - Intronic
1061625055 9:131836681-131836703 GGCCACCTGCACATGCCCTGAGG + Intergenic
1061712103 9:132495353-132495375 GCCCACCTGCACCTGCCTTGAGG + Intronic
1062293088 9:135806241-135806263 GGCCAGCTGGACAGTCCCTGTGG - Intergenic
1185516221 X:701104-701126 GCCCACAAGGAAATTCCTTGTGG + Intergenic
1185735248 X:2490892-2490914 GGACGGCTGGACCTTCCTTGCGG + Intronic
1185817480 X:3169717-3169739 GCCCACGAGGAAATTCCTTGTGG - Intergenic
1186034317 X:5404402-5404424 TCCCACATGGAAATTCCTTGTGG - Intergenic
1187075773 X:15933033-15933055 GGGCACCTGGATGTTCTTTGGGG + Intergenic
1187713557 X:22078266-22078288 GGCCACATGGACATACCCTGAGG + Intronic
1188440416 X:30210374-30210396 GGCCACAGGGATATCCCTTGTGG + Intergenic
1188630057 X:32344957-32344979 GGCCAATTAGACTTTCCTTGTGG + Intronic
1188909085 X:35823457-35823479 GCCCACAAGGAAATTCCTTGTGG + Intergenic
1193179633 X:78439629-78439651 GCCCACAAGGAAATTCCTTGTGG + Intergenic
1193319698 X:80106876-80106898 GCCCAGCAGGAAATTCCTTGTGG + Intergenic
1193936317 X:87626603-87626625 GCCCACAAGGAAATTCCTTGTGG - Intronic
1194476513 X:94365817-94365839 GCCCACCAGGAAATTCCTTGTGG + Intergenic
1194483326 X:94454707-94454729 GCCCACAAGGAAATTCCTTGTGG + Intergenic
1194502454 X:94698396-94698418 GCCCACAAGGAAATTCCTTGTGG - Intergenic
1195566414 X:106344611-106344633 GCCCACATGGAAATTCCTTGTGG - Intergenic
1195647808 X:107252499-107252521 GCCCACGAGGAAATTCCTTGTGG + Intergenic
1196694144 X:118593095-118593117 GGCCACTTGGCCAGTCCTTTAGG + Intronic
1199150869 X:144485291-144485313 GACCACAAGGAAATTCCTTGTGG + Intergenic
1199398432 X:147367828-147367850 GCCCACAAGGAAATTCCTTGTGG - Intergenic
1200083838 X:153593056-153593078 GGCCACCATGAAATTCCTCGGGG + Intronic
1200614171 Y:5358796-5358818 GCCCACAAGGAAATTCCTTGTGG - Intronic
1201263185 Y:12180334-12180356 GTCCACAAGGAAATTCCTTGTGG + Intergenic
1201279374 Y:12327802-12327824 AGCCAGCAGTACATTCCTTGGGG + Intergenic
1201389497 Y:13481607-13481629 GCCCACAAGGAAATTCCTTGTGG - Intergenic