ID: 1034649219

View in Genome Browser
Species Human (GRCh38)
Location 7:152676177-152676199
Sequence GCGCGCGTGCGCACTGCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034649211_1034649219 18 Left 1034649211 7:152676136-152676158 CCAACTGCGCAGACTCTACGGCC 0: 1
1: 0
2: 0
3: 4
4: 31
Right 1034649219 7:152676177-152676199 GCGCGCGTGCGCACTGCGCCAGG 0: 1
1: 1
2: 0
3: 17
4: 112
1034649209_1034649219 25 Left 1034649209 7:152676129-152676151 CCATTCACCAACTGCGCAGACTC 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1034649219 7:152676177-152676199 GCGCGCGTGCGCACTGCGCCAGG 0: 1
1: 1
2: 0
3: 17
4: 112
1034649212_1034649219 -3 Left 1034649212 7:152676157-152676179 CCAGTCAAACCCGCCCACCCGCG 0: 1
1: 0
2: 0
3: 7
4: 61
Right 1034649219 7:152676177-152676199 GCGCGCGTGCGCACTGCGCCAGG 0: 1
1: 1
2: 0
3: 17
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034649219 Original CRISPR GCGCGCGTGCGCACTGCGCC AGG Intergenic
900163024 1:1233329-1233351 CCGAGCGGGCGCACTACGCCCGG + Exonic
900600430 1:3500438-3500460 ACGCACATGCGCACTGCGGCTGG - Intronic
901660103 1:10793979-10794001 GCGCCCGAGCGCAAAGCGCCGGG - Intronic
902535931 1:17119376-17119398 GCGAGCGCGGGCACTGCGGCGGG - Exonic
907296757 1:53460511-53460533 GTGCGCAGGCGCACTGGGCCAGG - Intronic
907351797 1:53838121-53838143 TCGCGCGTGCGCGCTGGGCGGGG - Intronic
908796091 1:67832931-67832953 GCGGCCGTGCGCCCCGCGCCGGG - Intronic
914869120 1:151458811-151458833 GCGCGCGCGCGCGCCGCGGCGGG + Intronic
914919582 1:151838347-151838369 GCGCGAGAGCGTGCTGCGCCTGG - Exonic
914934083 1:151962625-151962647 ACAGGCGTGAGCACTGCGCCCGG + Intergenic
918020246 1:180680637-180680659 GCAGGCGTGAGCACTGCGCCCGG + Intronic
919201285 1:194358253-194358275 GAGTGCGTGCGCACGGCACCGGG - Intergenic
920924570 1:210329288-210329310 GGCCGCGCGCGCAGTGCGCCCGG + Intronic
924560434 1:245153998-245154020 GCGCTCCTGGGCGCTGCGCCGGG + Intergenic
1069673907 10:70233501-70233523 GTGCGCAGGCGCACTCCGCCAGG + Intronic
1074618344 10:115093038-115093060 GCGCGCGCGCCCACCCCGCCTGG - Intergenic
1077263141 11:1633963-1633985 ACACGCGTGCACACTGCCCCTGG - Intergenic
1082810471 11:57476451-57476473 GCGCGCGGCCGCTCTGGGCCTGG + Exonic
1085396813 11:76210552-76210574 GGGCCCGTGCGCACTCCGGCTGG + Intronic
1086959725 11:92969764-92969786 GGGCGGGTGGGCAGTGCGCCCGG + Exonic
1089543596 11:119206064-119206086 GCTCGCGTGCCCACAGCTCCCGG - Exonic
1092256205 12:6927987-6928009 GCGCGGGTGCGGGCTGCGCTAGG + Intronic
1094218604 12:27970632-27970654 GAGGGCGTGCGGACTGCCCCGGG + Intronic
1103595369 12:122021874-122021896 CGGCGCTTGCGCACTGGGCCAGG + Exonic
1105409614 13:20160984-20161006 TCACGCGTGCGCCCCGCGCCAGG + Exonic
1106454526 13:29915587-29915609 GTGTGCGTGCGCACTGAGCAAGG + Intergenic
1109062067 13:57632450-57632472 TCGCGCGCGCACGCTGCGCCAGG + Exonic
1114464099 14:22908679-22908701 CCCCGCGTGAGCACCGCGCCAGG + Intronic
1118887550 14:69879463-69879485 GCGAGCGTGTGCTCTGCGCGCGG - Exonic
1122930993 14:104933056-104933078 GCCCGGGTCCGCACTGCGCCAGG + Exonic
1126849881 15:52790404-52790426 TCGCGCATGCGCGCTGCGCCTGG - Intronic
1127931609 15:63600781-63600803 ACGCCTGCGCGCACTGCGCCTGG + Intronic
1128109527 15:65067877-65067899 ACGGGCGGGCGCACTGCGCGGGG - Exonic
1128124970 15:65185421-65185443 GCGCGCCTGCGCCCTAGGCCCGG + Intergenic
1129644845 15:77420250-77420272 GCGCGCGTGCTCACGGCTCCAGG - Intergenic
1133188483 16:4116472-4116494 CCGCGCGTGCGCGCTGCGGCTGG - Intergenic
1136605444 16:31330471-31330493 GAGCGGGTGGGCACTGCACCTGG - Intronic
1137583354 16:49648363-49648385 ACAGGCGTGAGCACTGCGCCTGG - Intronic
1141518364 16:84561446-84561468 ACAGGTGTGCGCACTGCGCCTGG + Intergenic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1143854280 17:9837129-9837151 ACAGGCGTGAGCACTGCGCCTGG + Intronic
1147015669 17:37489811-37489833 GCGCGCACGCTCCCTGCGCCTGG - Exonic
1151933404 17:77247211-77247233 GCGCGTCTGCGCACCGGGCCGGG + Intergenic
1152809546 17:82375080-82375102 GGGGGCGCGCGCGCTGCGCCTGG + Exonic
1157041630 18:44046210-44046232 ACACGCGTGAGCACTGTGCCTGG + Intergenic
1161443278 19:4304588-4304610 GTGCGCCTGCGCAATGCGCGCGG + Exonic
1162954508 19:14090796-14090818 CCGCACGCGCGCCCTGCGCCCGG + Intronic
1163012244 19:14433445-14433467 GCGCGCGTGCGCCCCGGGCGTGG - Intronic
1163547355 19:17948161-17948183 GCCCCCATGCGCACTGCGGCGGG - Intergenic
1167469176 19:49665959-49665981 CCGCGCCTGCGCACTGGGCCGGG - Exonic
1167517054 19:49929552-49929574 CTGCGCATGCGCACTGGGCCCGG + Intronic
1168408073 19:56121032-56121054 GCGCGCGTGCGCGCTGCTGGGGG - Intronic
927973136 2:27318341-27318363 ACAGGCGTGAGCACTGCGCCCGG + Intronic
931649372 2:64454392-64454414 GCGCGCGCGCGCCCGGGGCCCGG - Exonic
932355875 2:71068267-71068289 TTGCGCGTGCGCACTGCTCTTGG - Exonic
935011624 2:99141405-99141427 GTACGCGTGCGCACCGGGCCTGG - Intronic
937221470 2:120345168-120345190 GCGAGCGAGGGCACTGCACCCGG + Intergenic
943068001 2:183108858-183108880 ACGGGCGTGAGCCCTGCGCCTGG + Intergenic
944427710 2:199600430-199600452 ACGGGCGTGAGCACCGCGCCCGG + Intergenic
944675549 2:202032665-202032687 GCGCGCGAGCGCCCAGCGCCTGG + Intergenic
948601776 2:239111583-239111605 ACGCGGGTGAGGACTGCGCCCGG + Exonic
948816215 2:240511651-240511673 GCACGCCTGCGCACGGGGCCTGG - Intronic
1169673783 20:8132446-8132468 GCGCGCGGGGGCGCAGCGCCCGG - Intronic
1171452840 20:25248027-25248049 CCGCGCCTGCGCGCCGCGCCGGG - Intergenic
1178358347 21:31927365-31927387 GCAGGCGTGAGCACTGCGCCCGG - Intronic
1180208542 21:46278947-46278969 ACAGGCGTGAGCACTGCGCCCGG + Intronic
1180233644 21:46443357-46443379 GTGGGCATGAGCACTGCGCCTGG + Intronic
1180784225 22:18537965-18537987 ACAGGCGTGAGCACTGCGCCCGG + Intergenic
1181127792 22:20712017-20712039 ACAGGCGTGAGCACTGCGCCCGG + Intronic
1181241126 22:21477317-21477339 ACAGGCGTGAGCACTGCGCCCGG + Intergenic
1181831609 22:25564784-25564806 GCGCGCGTGCGCGGGGCGCCGGG + Intergenic
1182144761 22:27990635-27990657 CCGCGGGTGCGCACTGCTGCTGG - Intronic
1182604007 22:31489604-31489626 GGGCGCGGGCGCATTGCTCCCGG - Intronic
1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG + Intronic
1185142533 22:49110943-49110965 GCGCGCCTGGGCACTGCGGAGGG - Intergenic
950168143 3:10816688-10816710 GTGCGCGTGCGCACTGGCACAGG - Intronic
953410079 3:42685819-42685841 GCGCGCGGGCGAGCTGCACCTGG + Exonic
953705307 3:45226127-45226149 CGGCGCGCCCGCACTGCGCCCGG - Exonic
961069231 3:123906051-123906073 ACAGGCGTGAGCACTGCGCCCGG - Intronic
961540812 3:127598226-127598248 GAGCGCACGCGCACAGCGCCGGG + Exonic
968033166 3:195521037-195521059 ACAGGCGTGAGCACTGCGCCCGG - Intronic
968765983 4:2469415-2469437 CCGCGCGGGCGCACCGAGCCCGG + Intronic
977574090 4:98658739-98658761 GCGCGCGCGCGCACGGGGTCGGG + Intergenic
984823656 4:183905962-183905984 CCGCGCGCACGCACAGCGCCCGG + Exonic
986184470 5:5422883-5422905 GCGTGCGTGCCCACCGGGCCCGG + Exonic
987193178 5:15500163-15500185 GCCCGCGGGCGAGCTGCGCCGGG + Intergenic
988577976 5:32444751-32444773 GCGCGCCTGCGCAGTGCGGTCGG - Exonic
992534908 5:77689979-77690001 ACAGGCGTGAGCACTGCGCCTGG + Intergenic
998990873 5:147814883-147814905 ACAGGCGTGAGCACTGCGCCTGG - Intergenic
999374945 5:151080653-151080675 GCGCGCGTGCGCACTGCGCGGGG - Intronic
1000037512 5:157460276-157460298 ACGCGCGGGCGGACGGCGCCCGG - Exonic
1002559479 5:180071794-180071816 GCGCGCGCGCGGCCTGCGCGGGG + Exonic
1002580949 5:180209165-180209187 GCGCTCGTGCGGGCTGCGCTGGG - Intergenic
1002692412 5:181059485-181059507 GCGCGCCTGAGCCCTGCGGCCGG + Exonic
1005762185 6:28977575-28977597 GCGGGCGTCCGCACCGGGCCTGG + Intergenic
1007436137 6:41812415-41812437 GCAGGCGTGAGCACTGCGCCCGG - Intronic
1011610456 6:89146029-89146051 GGCCGCGTGCGCGCTCCGCCGGG + Exonic
1015181480 6:130366155-130366177 GCGCGCCTGGACTCTGCGCCCGG + Intronic
1017103241 6:150866202-150866224 GCGGGCTTGGGCACTGCGGCCGG + Intronic
1019143779 6:169963889-169963911 GCGCGCGTGCGTGCTCCTCCAGG + Intergenic
1019212950 6:170421400-170421422 CCGCGCGTGCGCTGTGAGCCGGG + Intergenic
1019212958 6:170421433-170421455 CCGCGCGTGCGCTGTGAGCCGGG + Intergenic
1020192309 7:6009515-6009537 CCGCGCGTGCGCACTGGGCGGGG - Intronic
1023067272 7:36390154-36390176 GCGCGCGTGCGCAGTGTGTGCGG + Intronic
1023881836 7:44325256-44325278 GCGCGGGCCCGCAGTGCGCCTGG + Intronic
1024335566 7:48202895-48202917 GAGCGCGGGCGCACGGCACCGGG - Intronic
1026091321 7:67302918-67302940 CCGCGCGTGCGCACTTGGCGCGG - Intergenic
1026745098 7:73005537-73005559 CCGCGCGTGCGCAGTGGGCGGGG + Intergenic
1026822319 7:73557757-73557779 GCGCGCCTGCGCGCCCCGCCCGG + Exonic
1027031210 7:74890232-74890254 CCGCGCGTGCGCAGTGGGCGGGG + Intergenic
1027098642 7:75359543-75359565 CCGCGCGTGCGCAGTGGGCGGGG - Intergenic
1029399741 7:100336355-100336377 CCGCGCGTGCGCAGTGGGCGGGG - Intronic
1034342625 7:150368352-150368374 GCAAGCGTCCGCACTGCGGCCGG + Intronic
1034425143 7:151010152-151010174 GCCCCCGTGCACGCTGCGCCAGG + Exonic
1034649219 7:152676177-152676199 GCGCGCGTGCGCACTGCGCCAGG + Intergenic
1038816871 8:30913027-30913049 CGGCGCTTGCGCACTGCGCCGGG + Intergenic
1039477212 8:37845658-37845680 ACAGGCGTGAGCACTGCGCCTGG - Intronic
1039936524 8:42051459-42051481 GCGCGCGTGCCGGCTGTGCCGGG - Intronic
1042532878 8:69833035-69833057 GAGCGAGTGCACCCTGCGCCGGG + Exonic
1044128214 8:88485078-88485100 GCGCGCTTTCGAACAGCGCCTGG - Intergenic
1045275132 8:100697347-100697369 ACAGGCGTGAGCACTGCGCCCGG - Intronic
1049036664 8:140081620-140081642 ACAGGCGTGAGCACTGCGCCCGG + Intronic
1056985678 9:91361952-91361974 GCGCGCACGCGCACGGCGTCCGG + Intergenic
1057489562 9:95510851-95510873 GCGCGCGCGCGCCCGGCTCCCGG + Intronic
1060643861 9:125261775-125261797 GCGCGCGTGCGCAGCGCCGCGGG - Intronic
1061575346 9:131502887-131502909 GCGCGCGTGCGCACTGGGAGAGG - Intronic
1062611575 9:137377170-137377192 CCGGGCGTGGCCACTGCGCCTGG - Intronic
1185610526 X:1391688-1391710 CCACGCGTGCGCACTGGGCCCGG - Intronic
1190285417 X:48957958-48957980 GCGCGCGTGCGCAGCGCCCCGGG - Intronic
1190845016 X:54183273-54183295 GGGCGCGTGCGCACTCCGCGGGG + Intronic
1190881652 X:54496007-54496029 GCGCGCGTGTGCGCTGCGCTTGG + Exonic