ID: 1034649219

View in Genome Browser
Species Human (GRCh38)
Location 7:152676177-152676199
Sequence GCGCGCGTGCGCACTGCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034649212_1034649219 -3 Left 1034649212 7:152676157-152676179 CCAGTCAAACCCGCCCACCCGCG 0: 1
1: 0
2: 0
3: 7
4: 61
Right 1034649219 7:152676177-152676199 GCGCGCGTGCGCACTGCGCCAGG 0: 1
1: 1
2: 0
3: 17
4: 112
1034649211_1034649219 18 Left 1034649211 7:152676136-152676158 CCAACTGCGCAGACTCTACGGCC 0: 1
1: 0
2: 0
3: 4
4: 31
Right 1034649219 7:152676177-152676199 GCGCGCGTGCGCACTGCGCCAGG 0: 1
1: 1
2: 0
3: 17
4: 112
1034649209_1034649219 25 Left 1034649209 7:152676129-152676151 CCATTCACCAACTGCGCAGACTC 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1034649219 7:152676177-152676199 GCGCGCGTGCGCACTGCGCCAGG 0: 1
1: 1
2: 0
3: 17
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034649219 Original CRISPR GCGCGCGTGCGCACTGCGCC AGG Intergenic