ID: 1034655205

View in Genome Browser
Species Human (GRCh38)
Location 7:152723672-152723694
Sequence CTGGTTCTGGATTTTGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034655205_1034655218 26 Left 1034655205 7:152723672-152723694 CCCCCCACAAAATCCAGAACCAG No data
Right 1034655218 7:152723721-152723743 TGCAATCCCAGCACTTTGGGAGG 0: 5425
1: 297008
2: 267045
3: 155244
4: 134504
1034655205_1034655216 22 Left 1034655205 7:152723672-152723694 CCCCCCACAAAATCCAGAACCAG No data
Right 1034655216 7:152723717-152723739 TGCTTGCAATCCCAGCACTTTGG 0: 100
1: 6093
2: 105130
3: 241217
4: 244846
1034655205_1034655213 -8 Left 1034655205 7:152723672-152723694 CCCCCCACAAAATCCAGAACCAG No data
Right 1034655213 7:152723687-152723709 AGAACCAGAAAGGCCAGGCATGG No data
1034655205_1034655217 23 Left 1034655205 7:152723672-152723694 CCCCCCACAAAATCCAGAACCAG No data
Right 1034655217 7:152723718-152723740 GCTTGCAATCCCAGCACTTTGGG 0: 173
1: 12448
2: 237428
3: 275507
4: 182787

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034655205 Original CRISPR CTGGTTCTGGATTTTGTGGG GGG (reversed) Intergenic
No off target data available for this crispr