ID: 1034655213

View in Genome Browser
Species Human (GRCh38)
Location 7:152723687-152723709
Sequence AGAACCAGAAAGGCCAGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034655207_1034655213 -10 Left 1034655207 7:152723674-152723696 CCCCACAAAATCCAGAACCAGAA No data
Right 1034655213 7:152723687-152723709 AGAACCAGAAAGGCCAGGCATGG No data
1034655205_1034655213 -8 Left 1034655205 7:152723672-152723694 CCCCCCACAAAATCCAGAACCAG No data
Right 1034655213 7:152723687-152723709 AGAACCAGAAAGGCCAGGCATGG No data
1034655203_1034655213 29 Left 1034655203 7:152723635-152723657 CCTGGGAGACAGAGCAAGACCTT 0: 43
1: 1364
2: 10797
3: 46922
4: 119222
Right 1034655213 7:152723687-152723709 AGAACCAGAAAGGCCAGGCATGG No data
1034655206_1034655213 -9 Left 1034655206 7:152723673-152723695 CCCCCACAAAATCCAGAACCAGA No data
Right 1034655213 7:152723687-152723709 AGAACCAGAAAGGCCAGGCATGG No data
1034655204_1034655213 10 Left 1034655204 7:152723654-152723676 CCTTGTCTCTAAAAATAACCCCC No data
Right 1034655213 7:152723687-152723709 AGAACCAGAAAGGCCAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034655213 Original CRISPR AGAACCAGAAAGGCCAGGCA TGG Intergenic
No off target data available for this crispr