ID: 1034655218

View in Genome Browser
Species Human (GRCh38)
Location 7:152723721-152723743
Sequence TGCAATCCCAGCACTTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 859226
Summary {0: 5425, 1: 297008, 2: 267045, 3: 155244, 4: 134504}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034655212_1034655218 13 Left 1034655212 7:152723685-152723707 CCAGAACCAGAAAGGCCAGGCAT No data
Right 1034655218 7:152723721-152723743 TGCAATCCCAGCACTTTGGGAGG 0: 5425
1: 297008
2: 267045
3: 155244
4: 134504
1034655208_1034655218 23 Left 1034655208 7:152723675-152723697 CCCACAAAATCCAGAACCAGAAA No data
Right 1034655218 7:152723721-152723743 TGCAATCCCAGCACTTTGGGAGG 0: 5425
1: 297008
2: 267045
3: 155244
4: 134504
1034655207_1034655218 24 Left 1034655207 7:152723674-152723696 CCCCACAAAATCCAGAACCAGAA No data
Right 1034655218 7:152723721-152723743 TGCAATCCCAGCACTTTGGGAGG 0: 5425
1: 297008
2: 267045
3: 155244
4: 134504
1034655205_1034655218 26 Left 1034655205 7:152723672-152723694 CCCCCCACAAAATCCAGAACCAG No data
Right 1034655218 7:152723721-152723743 TGCAATCCCAGCACTTTGGGAGG 0: 5425
1: 297008
2: 267045
3: 155244
4: 134504
1034655206_1034655218 25 Left 1034655206 7:152723673-152723695 CCCCCACAAAATCCAGAACCAGA No data
Right 1034655218 7:152723721-152723743 TGCAATCCCAGCACTTTGGGAGG 0: 5425
1: 297008
2: 267045
3: 155244
4: 134504
1034655214_1034655218 7 Left 1034655214 7:152723691-152723713 CCAGAAAGGCCAGGCATGGTAGC No data
Right 1034655218 7:152723721-152723743 TGCAATCCCAGCACTTTGGGAGG 0: 5425
1: 297008
2: 267045
3: 155244
4: 134504
1034655209_1034655218 22 Left 1034655209 7:152723676-152723698 CCACAAAATCCAGAACCAGAAAG No data
Right 1034655218 7:152723721-152723743 TGCAATCCCAGCACTTTGGGAGG 0: 5425
1: 297008
2: 267045
3: 155244
4: 134504
1034655215_1034655218 -2 Left 1034655215 7:152723700-152723722 CCAGGCATGGTAGCTCATGCTTG 0: 22
1: 859
2: 11886
3: 47962
4: 112728
Right 1034655218 7:152723721-152723743 TGCAATCCCAGCACTTTGGGAGG 0: 5425
1: 297008
2: 267045
3: 155244
4: 134504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034655218 Original CRISPR TGCAATCCCAGCACTTTGGG AGG Intergenic
Too many off-targets to display for this crispr