ID: 1034658045

View in Genome Browser
Species Human (GRCh38)
Location 7:152744932-152744954
Sequence TGCTGAGGCAATGGAGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034658045_1034658050 -9 Left 1034658045 7:152744932-152744954 CCTCAGCCTCCATTGCCTCAGCA No data
Right 1034658050 7:152744946-152744968 GCCTCAGCAATGGAGTAGCTGGG No data
1034658045_1034658049 -10 Left 1034658045 7:152744932-152744954 CCTCAGCCTCCATTGCCTCAGCA No data
Right 1034658049 7:152744945-152744967 TGCCTCAGCAATGGAGTAGCTGG No data
1034658045_1034658053 18 Left 1034658045 7:152744932-152744954 CCTCAGCCTCCATTGCCTCAGCA No data
Right 1034658053 7:152744973-152744995 CAGGCGCATGTCACCACACTTGG 0: 6
1: 83
2: 1487
3: 9746
4: 34364
1034658045_1034658052 -1 Left 1034658045 7:152744932-152744954 CCTCAGCCTCCATTGCCTCAGCA No data
Right 1034658052 7:152744954-152744976 AATGGAGTAGCTGGGACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034658045 Original CRISPR TGCTGAGGCAATGGAGGCTG AGG (reversed) Intergenic
No off target data available for this crispr