ID: 1034664546

View in Genome Browser
Species Human (GRCh38)
Location 7:152805089-152805111
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 2, 1: 0, 2: 0, 3: 14, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034664543_1034664546 7 Left 1034664543 7:152805059-152805081 CCTCACTAGCTTTTGTATGCTGT 0: 2
1: 0
2: 1
3: 22
4: 171
Right 1034664546 7:152805089-152805111 TTGGAGCATGTACAGTTGGTTGG 0: 2
1: 0
2: 0
3: 14
4: 117
1034664542_1034664546 8 Left 1034664542 7:152805058-152805080 CCCTCACTAGCTTTTGTATGCTG 0: 2
1: 0
2: 0
3: 7
4: 144
Right 1034664546 7:152805089-152805111 TTGGAGCATGTACAGTTGGTTGG 0: 2
1: 0
2: 0
3: 14
4: 117
1034664541_1034664546 28 Left 1034664541 7:152805038-152805060 CCTCATTGTTCTGGCTTGTACCC 0: 2
1: 0
2: 0
3: 10
4: 177
Right 1034664546 7:152805089-152805111 TTGGAGCATGTACAGTTGGTTGG 0: 2
1: 0
2: 0
3: 14
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905146272 1:35889130-35889152 TTGTAGGATGCACAGTTGGAGGG + Intronic
906091480 1:43183184-43183206 TTGAAGGATGTTCAGTTGGTAGG + Intronic
909559731 1:76996694-76996716 TTTCAGTATGTACAGTTGGAAGG + Intronic
919245356 1:194975941-194975963 TTAGAGTATGTTCAGTTGCTTGG - Intergenic
921370857 1:214421832-214421854 TTGGAGCATGGACAGATGATTGG - Intronic
924381895 1:243473174-243473196 TGGGACCATGTACACTTGGAAGG - Intronic
924698949 1:246430490-246430512 TTGGAGCCAGCACATTTGGTAGG + Intronic
1062777229 10:162171-162193 TGGGAGAATGAGCAGTTGGTGGG + Intronic
1067321452 10:45224680-45224702 TTGGCGCGTGTTCAGTTGATGGG + Intergenic
1070424185 10:76269277-76269299 TTGGAGCATGTAAAATTTATTGG - Intronic
1074727061 10:116321945-116321967 ATGGAACATGTACAGATGGAAGG + Intergenic
1076637785 10:131893598-131893620 TTGGGGCATGGACATTTGGAGGG + Intergenic
1077099572 11:816116-816138 TTGGAGCTTGTCCTGATGGTGGG + Intergenic
1077762706 11:5120940-5120962 TTGGAGCATTTATTGTTGGTGGG - Intergenic
1077772216 11:5232418-5232440 TTGGAGCAGGAACACTTGATGGG + Intergenic
1079386474 11:19984391-19984413 TAGGAGCAGGTACAGTAGGTAGG + Intronic
1081017414 11:37900111-37900133 TTGGAGCACACACAGTTTGTGGG - Intergenic
1086054161 11:82627900-82627922 CAGGTGCATGTCCAGTTGGTGGG - Intergenic
1086230311 11:84561103-84561125 TTGGAGTATGTGCAGTGAGTAGG + Intronic
1087469903 11:98559847-98559869 TTTGAGCTTGTACAGTGGGAAGG - Intergenic
1087791620 11:102411869-102411891 CTGGAGCATATACAGTTGGGGGG + Intronic
1088119255 11:106348960-106348982 TTGGAGCATGTAAAGTTTTGAGG - Intergenic
1091573446 12:1711451-1711473 TAGGTGCCTGTCCAGTTGGTGGG + Intronic
1097510426 12:60531790-60531812 TTGGAGCTTGGACTCTTGGTAGG + Intergenic
1100430301 12:94526271-94526293 TTGGGGCAGATGCAGTTGGTTGG - Intergenic
1102456428 12:113073598-113073620 TTGGGGCCTGTCCAGTTGGCAGG + Intronic
1103808770 12:123596032-123596054 TTGGAGTATGTTGAGTTGCTTGG + Intronic
1103974650 12:124694610-124694632 TTGCAGCATGTACAGTTCAGTGG + Intergenic
1104797024 12:131527081-131527103 CTGGAGCATGGCCAGTTGGGAGG - Intergenic
1108112729 13:47093725-47093747 TTGGAGGAGGAACAGTTGGCAGG - Intergenic
1109226885 13:59707807-59707829 TTGGAGCATGGACAGTTCATCGG - Intronic
1114283219 14:21214185-21214207 TTGGAGTTAGAACAGTTGGTAGG - Intronic
1114730623 14:24989122-24989144 TTGGAGGTTGTAGAGATGGTGGG - Intronic
1119634026 14:76259282-76259304 TTTGAGCATATACAGTGTGTAGG - Intergenic
1120414423 14:84201368-84201390 TTGTGACATGTTCAGTTGGTGGG + Intergenic
1121124869 14:91399478-91399500 TTGGAGAATGCACAGGTGTTGGG - Intronic
1122286990 14:100658198-100658220 TTGGGGCAAGAACAGTAGGTGGG + Intergenic
1124824311 15:33078301-33078323 ATGGAGCATGTGCAGGTGGTGGG + Intronic
1125786304 15:42321441-42321463 TTGGACCTTGTAGAGTTAGTGGG - Intronic
1128240284 15:66096791-66096813 TTGGAGAAGGCACAGGTGGTAGG - Intronic
1128783434 15:70377854-70377876 TGTATGCATGTACAGTTGGTGGG + Intergenic
1130742266 15:86613369-86613391 TTGGTGCGTGGACAGTTAGTGGG + Intronic
1134104661 16:11477072-11477094 TTGGCGCATGTACAGCCTGTGGG - Intronic
1143028892 17:3956385-3956407 TTGGAGCATTGACTTTTGGTGGG + Intronic
1144753500 17:17666164-17666186 TTGGTGCATGTCCACGTGGTGGG - Intergenic
1160349548 18:78164592-78164614 TTGGATCAGGTCCTGTTGGTTGG + Intergenic
926928169 2:18009272-18009294 TTGGATCATTTCCAGTTGGGAGG - Intronic
927049456 2:19312492-19312514 CTGGAGCATGAACAGCAGGTAGG + Intergenic
929481745 2:42314731-42314753 TGGCAGCATGCACAGCTGGTTGG - Intronic
932078934 2:68693460-68693482 GTGCAGCATGTACAGGAGGTGGG + Intronic
933184666 2:79265865-79265887 TAGGTGCATGTATAGTTAGTGGG + Intronic
934572768 2:95383015-95383037 TTGGAGCCTCAGCAGTTGGTTGG + Intronic
935844859 2:107154647-107154669 TAAGAGAATGTACAGTTGCTTGG - Intergenic
936598071 2:113868445-113868467 TTGGAGTGTGTACAGTATGTCGG + Intergenic
936656130 2:114489686-114489708 TGGGAGCATATGAAGTTGGTAGG + Intronic
936963883 2:118106498-118106520 TTGGAGGGGTTACAGTTGGTAGG + Intronic
939577258 2:143911265-143911287 ATGGCTCATGCACAGTTGGTGGG - Intergenic
940972233 2:159906474-159906496 TTTGAGCAGGCACAGCTGGTGGG + Intergenic
943731640 2:191308570-191308592 TTGCAGCATGTTATGTTGGTGGG - Intronic
945755228 2:213837650-213837672 TTGGGGCATGGACATTTGCTGGG - Intronic
948306496 2:236951826-236951848 CAGGATCATGTACTGTTGGTGGG + Intergenic
1184219800 22:43092540-43092562 TTTGCAAATGTACAGTTGGTTGG - Intergenic
1184670388 22:46009263-46009285 TGGGCACATGTACAGTTGGGTGG - Intergenic
949462369 3:4306442-4306464 TTGTTACATCTACAGTTGGTGGG + Intronic
951506798 3:23455920-23455942 CTGTAGCATGAACAGTTGTTTGG + Intronic
952039376 3:29243204-29243226 TTGCAGGATGTAAGGTTGGTAGG + Intergenic
953535450 3:43773738-43773760 TTGGTTCATGTAAAGTTGGCTGG + Intergenic
953891405 3:46754237-46754259 ATGGAGCATGTATTGTTGGTGGG + Intronic
953896889 3:46809905-46809927 ATGGAGCATGTATTGTTGGTGGG + Intronic
956609207 3:71105145-71105167 TAGGGGCATGTACAGTTGCTAGG - Intronic
956979190 3:74615894-74615916 TTGGGACATGTACTGTTGATCGG + Intergenic
957537057 3:81519983-81520005 CTGGAGTATGTACATGTGGTTGG - Intronic
957756124 3:84490659-84490681 TTGGAAAATATACAGTTGGGGGG - Intergenic
959099890 3:101998440-101998462 GTGGAGCTTGTAGACTTGGTGGG + Intergenic
959316708 3:104817810-104817832 ATGGAGCTTTTACAGTTTGTAGG - Intergenic
959604919 3:108232249-108232271 TTGAAGCTTATACAGTTGGTAGG + Intergenic
962281712 3:134057230-134057252 TTGGGGCCTGTCCAGTTGGCTGG + Intergenic
962350989 3:134655599-134655621 TTGGAGCATACAGAGTTGGGTGG - Intronic
963648901 3:147951657-147951679 TTGGAAAATGGACAGTTGGTGGG - Intergenic
966586202 3:181628270-181628292 CAGGAGCATGAAGAGTTGGTGGG - Intergenic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
970168432 4:13264205-13264227 TTGATGTATGTACAGTTGGGTGG - Intergenic
977783913 4:101010603-101010625 TTAGAGTGTGTACAGTTTGTAGG - Intergenic
978577826 4:110203532-110203554 CAGGTGCCTGTACAGTTGGTGGG + Intergenic
978632909 4:110767555-110767577 AGGGAGCATGCACAGGTGGTTGG - Intergenic
981773145 4:148333553-148333575 TTGGAGAATGAAAAGTTGGAAGG + Intronic
981934723 4:150227473-150227495 CTGGAGCAGGAACAGTGGGTAGG + Intronic
982578470 4:157147319-157147341 TTGATCCATGAACAGTTGGTTGG - Intronic
982832152 4:160075945-160075967 TTGGAGCAAACACAGTTTGTGGG + Intergenic
984025626 4:174539809-174539831 TTGGAGAAGGTACAGTTGCCAGG + Intergenic
987818625 5:22934038-22934060 CAGGTGCCTGTACAGTTGGTGGG - Intergenic
990491778 5:56309856-56309878 ATGGAGCATGTACAGCTCTTAGG - Intergenic
993135868 5:83963281-83963303 TTTGGTCATGTACAGTTTGTTGG - Exonic
994744282 5:103659375-103659397 TTACAGAATGTACAGTTCGTAGG - Intergenic
994789878 5:104210151-104210173 TTGGCCCATGTACACTTGGATGG - Intergenic
998980880 5:147700943-147700965 TTTGAGCATATTCATTTGGTTGG + Intronic
1001159420 5:169300585-169300607 GCGGAGCAGGTACACTTGGTGGG + Exonic
1004920773 6:20373467-20373489 TTGTAGCATGAACAGTAGTTTGG + Intergenic
1008753573 6:54766597-54766619 TTGTAGTATGTACACTGGGTTGG - Intergenic
1011502247 6:88003677-88003699 ATGGAGCATGGACAGTTTGTAGG + Intergenic
1012052964 6:94366557-94366579 ATGGACCAAGTACAGTTGTTTGG + Intergenic
1017603501 6:156108521-156108543 TTGGTTCTTGTAAAGTTGGTGGG + Intergenic
1018993533 6:168692884-168692906 TTGGAGTATGTCCAGTAGGTCGG - Intergenic
1019127909 6:169853563-169853585 CTGGAGCATGCACACTTTGTAGG + Intergenic
1022652946 7:32293833-32293855 TTGGAGCTTTTACACCTGGTTGG - Intronic
1022828622 7:34042476-34042498 TTTCAGCATGTAAAGCTGGTAGG - Intronic
1026563517 7:71470326-71470348 TTGGAGGATGTTTGGTTGGTGGG + Intronic
1028425162 7:90678209-90678231 TTGGAGGATGGGCGGTTGGTGGG + Intronic
1032665348 7:134030623-134030645 TTGGAGCAAATACACTTTGTGGG + Intronic
1034333497 7:150304801-150304823 TTGGAGCATGTACAGTTGGTTGG - Intronic
1034664546 7:152805089-152805111 TTGGAGCATGTACAGTTGGTTGG + Intronic
1035222148 7:157412381-157412403 TGTAAGCATGTACAGTTGTTCGG - Intronic
1036107055 8:5852696-5852718 CTGGAGCAAGCACAGTTTGTGGG + Intergenic
1036211124 8:6842056-6842078 ATGGAGCAGGAACATTTGGTTGG + Intergenic
1037990050 8:23315282-23315304 TTCTAGCATATGCAGTTGGTGGG + Intronic
1040971013 8:53137717-53137739 TGGGTGCCTGTCCAGTTGGTGGG + Intergenic
1041985494 8:63917687-63917709 GTAGAGCATGTACAGTGTGTAGG - Intergenic
1045324804 8:101110030-101110052 TTAGAACATGTCCAGTTGGGTGG + Intergenic
1045513631 8:102836630-102836652 TTGTAGCATCAAGAGTTGGTTGG + Intronic
1046584270 8:116132117-116132139 TTGGAGTATGTAGATTTTGTCGG + Intergenic
1048017624 8:130511794-130511816 TTGCATCATGTACAGTTTGCAGG + Intergenic
1048591299 8:135823289-135823311 GTGGAGCATGAACAGTACGTTGG + Intergenic
1049155930 8:141066810-141066832 TTGATGCATGTATAGATGGTTGG - Intergenic
1057553736 9:96071361-96071383 TTGGGGCATGTACAGGTTGGAGG + Intergenic
1188701706 X:33272305-33272327 TTGGACGATGTTGAGTTGGTTGG + Intronic
1189149340 X:38688227-38688249 TTGGACCAAGTACAGATGGAGGG - Exonic
1189411967 X:40780319-40780341 TTGGAGCCAGTACACTTGGGAGG - Intergenic
1193758895 X:85441179-85441201 TTGGAGCATGTAAAGCTTATGGG + Intergenic
1194206728 X:91019322-91019344 TGGGAGCATGTAAAGTTGCCTGG + Intergenic
1194241253 X:91452195-91452217 TTGGAGCATGTACACTAGCCAGG + Intergenic
1198720289 X:139610727-139610749 TTAGAGCATCTACACTTGTTTGG + Intronic
1200552476 Y:4594111-4594133 TGGGAGCATGTAAAGTTGCCTGG + Intergenic
1202020008 Y:20454221-20454243 TTGCAGCATGTTCTTTTGGTAGG - Intergenic