ID: 1034664558

View in Genome Browser
Species Human (GRCh38)
Location 7:152805215-152805237
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 2, 1: 0, 2: 1, 3: 27, 4: 247}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900782471 1:4627036-4627058 GTTTGAGATGTTCCAGTGCAGGG + Intergenic
901108443 1:6776106-6776128 TCTTGAGATGGGGCTGGGCGTGG + Intergenic
901316662 1:8314627-8314649 TTCTGGGCTGGGGCAGTGGATGG + Intergenic
901718720 1:11177757-11177779 TTTTGAGATTAGGAAGTGCGTGG + Intronic
902762193 1:18589058-18589080 TGTAGAGATGGGGCAGTCCTAGG - Intergenic
902952026 1:19892410-19892432 TTTTGCGGTGTGGCAGTGCCCGG + Intronic
907016729 1:51022751-51022773 TTTTGAGATGGGGGTATGGATGG - Intergenic
907183391 1:52590251-52590273 TTTTGGAATAGGGGAGTGCAGGG + Intergenic
908843573 1:68302320-68302342 TTCTGAGATGGGGAAGAGCAGGG + Intergenic
911046543 1:93633553-93633575 TTTTGAGATGGGCCACACCAGGG - Intronic
912379604 1:109240294-109240316 GTTGGAGATGGGGCAGGTCAAGG - Intergenic
913000301 1:114573523-114573545 TTAAGAGATGGGGCATTGCCAGG - Intronic
918183387 1:182105946-182105968 TTTTGAGATGGGGTTGAGAATGG + Intergenic
918287305 1:183069986-183070008 GTTTGAGATGGCACAGTGCCCGG + Intronic
919605774 1:199681575-199681597 CTTGGAGATAGGGCAGTGCAAGG + Intergenic
919814086 1:201426755-201426777 TTCTGAGAGGGGGCAGGGCTGGG + Intronic
920278137 1:204823819-204823841 TTGAGAGATGGGGCAGTGAATGG - Intergenic
921516272 1:216096383-216096405 ATTTCAGGTGGGGCAGTACAGGG - Intronic
923741327 1:236657720-236657742 TTTTGAGATGGAGCCTTGCTTGG + Intergenic
924946774 1:248851737-248851759 TTCTGAAGTGGTGCAGTGCATGG - Intronic
1064320253 10:14298197-14298219 TTTTGATATGGTGCAGAGGATGG - Intronic
1064548893 10:16478622-16478644 TTTTTAAATGGGGCTGGGCACGG - Intronic
1064750800 10:18526453-18526475 TATTGTGAGGGGGCAGTGGAGGG + Intronic
1067826227 10:49575420-49575442 TTTTGAGATGGGGTCTTGCTGGG + Intergenic
1071717608 10:88113178-88113200 TAGTGAGATAGGGCAGTGAAGGG - Intergenic
1072305814 10:94106037-94106059 TTTTAAGATGAGGCAGAGCTGGG + Intronic
1073211874 10:101810640-101810662 TTTTGAGAAGTGGCAATGAAAGG - Intronic
1073463929 10:103682835-103682857 TTTTGAAATGGGCCATTGGAGGG + Intronic
1074718792 10:116247126-116247148 TTCTGAGATGGGGCAGGGGTCGG - Intronic
1076466042 10:130682211-130682233 ACTTGAGATGGGTCAGAGCATGG + Intergenic
1077995581 11:7449586-7449608 TTTGGAGAAGGGGAAGTACAGGG + Intronic
1081413339 11:42785514-42785536 GTTTGAGATTAGGCAGTTCAGGG + Intergenic
1083344434 11:61979484-61979506 TTGTGAGATGGGGCAGGGCAGGG - Intergenic
1083344687 11:61981046-61981068 TTGTGAGATGCGGCAGGGCAGGG - Intergenic
1083770440 11:64864111-64864133 TGTTGAGCTGGGGCAGGGAACGG - Intronic
1084555434 11:69872913-69872935 TTTTTAAATGGTGCAGTGCAGGG + Intergenic
1086197762 11:84161440-84161462 TTTGGAGAGGGGGCAGTTAATGG + Intronic
1087370593 11:97279241-97279263 CTTTGAGGAGGGACAGTGCAGGG + Intergenic
1087992122 11:104758108-104758130 TTTTGGGATGTGGCAATGCAGGG - Intergenic
1088534995 11:110850872-110850894 TTGTGAGATAGGGCAGTGATGGG + Intergenic
1088906790 11:114161163-114161185 TTCTGAGATGGGCCAGTGTAAGG + Intronic
1089043741 11:115480740-115480762 TGGTGAGATGGAGCTGTGCAGGG - Intronic
1089605600 11:119639654-119639676 TTTTGAACTGGGGCGGTGCCTGG + Intronic
1089693165 11:120199216-120199238 TGGGGAGATGGGGCAGGGCAGGG - Intergenic
1089785370 11:120903566-120903588 TTTTAGGATGGGACAGTCCAGGG - Intronic
1093721422 12:22446806-22446828 TTTTGAGATGCGTCTATGCATGG - Intergenic
1094021621 12:25920648-25920670 TTTTAAGAAGTGTCAGTGCAGGG - Intergenic
1094822887 12:34240692-34240714 TTTTGAGATGGGGTCTTGCTCGG - Intergenic
1096364662 12:51018375-51018397 TTTTGAGATGGGGTCTTGCTTGG - Intronic
1097407758 12:59211839-59211861 TCTTGAGCTGGGGCAATGGAGGG + Intergenic
1097546426 12:61007511-61007533 TTTTAAGATGGGTAAGTGGAAGG - Intergenic
1097707214 12:62880714-62880736 TTTTGAGGTGGAGCTGAGCACGG - Intronic
1098376308 12:69819310-69819332 TATTGAGATGGGGAAATACATGG + Exonic
1099270342 12:80501095-80501117 TGTGGAGTTGGGGCAGAGCAGGG + Intronic
1099270367 12:80501391-80501413 TACTTAGATGGGGCAGTCCAGGG + Intronic
1103524878 12:121560987-121561009 TTTCCACATGGGGCAGTGCCTGG + Intronic
1106264209 13:28095562-28095584 TTTGGAGAGGGGGCCGGGCAAGG - Intronic
1107292819 13:38876287-38876309 TGATGTGATGGGGCAGTGCATGG - Exonic
1108356749 13:49635212-49635234 TTTGGAGCTGGGGAAGAGCATGG - Intergenic
1109857623 13:68153810-68153832 TTTTGTAATGGGGCAGGGCATGG - Intergenic
1112028546 13:95435944-95435966 TTTTAAGATGAGGCCGGGCAAGG - Intronic
1112825994 13:103393114-103393136 GGTTGAGAGGGGGCAGTGCAGGG + Intergenic
1114412902 14:22517545-22517567 TTTGGTGATGGGGAAGTACAAGG - Intergenic
1114827336 14:26097030-26097052 TTCTGAAATGGGTGAGTGCAAGG + Intergenic
1115834500 14:37384212-37384234 ATTTGAGATGAAGCAATGCATGG + Intronic
1115896900 14:38099522-38099544 GTTTGAGATGGGGTAGAGTATGG + Intergenic
1117375147 14:55112702-55112724 TTTGGGGATGGGGGAGTGGATGG + Intergenic
1120132873 14:80827468-80827490 TTTTGATATGTTGCTGTGCACGG - Intronic
1121273966 14:92655521-92655543 ATGTGAGATGGGGTCGTGCAGGG + Intronic
1121432977 14:93900408-93900430 TGGCGAGATGGGGCAGAGCATGG - Intergenic
1121642382 14:95494440-95494462 CTGGGAGATGGGGAAGTGCAAGG + Intergenic
1121747051 14:96305073-96305095 TATTGAGGTGGGGCATGGCATGG - Intronic
1122864216 14:104596273-104596295 TTTTGGCCTGGGGCACTGCATGG + Intronic
1123922762 15:25082073-25082095 ATTTGAGATGGGGCTGGGCACGG + Intergenic
1124722442 15:32121736-32121758 TTTTAAGATGGGGCATTTCATGG + Intronic
1126122967 15:45269805-45269827 TTTACAGCTGGGGCAGTCCAGGG + Intronic
1126752791 15:51894376-51894398 TTTTGAGATGGGACAGTGGCAGG - Intronic
1127008989 15:54601928-54601950 TTCTCAGATGGGGCAGTGGGTGG - Intronic
1127428021 15:58875042-58875064 TTGAGAGAAGGGGCAGGGCATGG + Intronic
1127790322 15:62392581-62392603 CTTTGTGATGGGACAGGGCACGG + Intronic
1127968698 15:63942710-63942732 TTTGGGGTTGGGGTAGTGCAGGG - Intronic
1129052311 15:72792697-72792719 TGTTGATATGTGGCAGTGCAGGG - Intergenic
1130560975 15:84958802-84958824 TTTTGAGATGGGGTCTTGCTGGG + Intergenic
1131975022 15:97935690-97935712 CTTTCAGATGGGTCAGTGCGGGG - Intergenic
1132414266 15:101609613-101609635 CATTGAGATGGGGCGGTGGAGGG + Intergenic
1133097959 16:3460136-3460158 CTCTGAGTTAGGGCAGTGCATGG + Intronic
1136225290 16:28856254-28856276 TTTTGAGATGGAGTCTTGCACGG - Intronic
1136399136 16:30008354-30008376 TTTTGGGAGGGGGCAGAGCTTGG + Intronic
1137514101 16:49127595-49127617 GTGTGAGATGGGGCAGGGCAGGG + Intergenic
1137934900 16:52625500-52625522 TTTAGAGATGTGTCAGTTCATGG + Intergenic
1141907285 16:87035386-87035408 TTTAGAGATAGAGCAGAGCAGGG + Intergenic
1143650612 17:8261997-8262019 TTTTGAGATGGGGTCTTGCTCGG - Intronic
1146201274 17:30860922-30860944 TTTTGAGATGGAGTCTTGCACGG + Intronic
1147986384 17:44309632-44309654 TTTTGGGACAGGGCAGGGCAGGG - Intronic
1148440253 17:47708511-47708533 CGGTGAGATGGGGCAGGGCAGGG + Exonic
1148575996 17:48711691-48711713 ATTTGAGATGGGGTATTGCTTGG - Intergenic
1148970362 17:51475399-51475421 TTTTGTGATTGGGTGGTGCAGGG + Intergenic
1150830696 17:68516900-68516922 TTTTGAAATGGGTCACTGTAAGG + Intronic
1151285488 17:73107994-73108016 TCTTGAGATGGGGCCGGGCGTGG + Intergenic
1151500689 17:74486480-74486502 TTTTGAGTGTGGGCAGGGCATGG - Intergenic
1151784270 17:76267522-76267544 TTTTGAGAAAGGCCAGGGCAGGG + Intronic
1152379603 17:79935467-79935489 TTCTGAGATGGGGGAGGGGAAGG - Exonic
1152803757 17:82344836-82344858 TTGTGAGATGTGGCAGCCCAGGG - Intergenic
1154974654 18:21445182-21445204 ATTTGAGATGTGGCCGGGCACGG + Intronic
1155139862 18:23035345-23035367 TTTAGAGATCGGGGGGTGCAGGG + Intergenic
1155831938 18:30527004-30527026 TTGGGAGAAGGGGCAGTGAAAGG + Intergenic
1156846873 18:41676035-41676057 TGTTGAGTTGGGGCCATGCAAGG + Intergenic
1158126058 18:54100632-54100654 TGCTGCAATGGGGCAGTGCATGG - Intergenic
1159680532 18:71345474-71345496 TTTTGAGATGAAGCATTGCTAGG + Intergenic
1160553439 18:79711002-79711024 TATTGGGATGGGGCAGAGCCTGG - Intronic
1160744260 19:703493-703515 GTTTGAGCTGGGGCAGGCCAGGG + Intergenic
1160921047 19:1520736-1520758 TTTTGCAAAGGGGCAGGGCAGGG - Intergenic
1162089941 19:8272749-8272771 TTTTGAGATGGAGTTGTGCTCGG - Intronic
1162092173 19:8287605-8287627 TTTTGAGATGGAGTCGTGCTCGG - Intronic
1162162191 19:8726544-8726566 TTGTGATAGGGGGAAGTGCAGGG - Intergenic
1163238515 19:16043769-16043791 TTTAGGGATGGGCCAGAGCAAGG + Intergenic
1163741471 19:19016328-19016350 TTTGGATAGGGGGCAGGGCAGGG - Intronic
1164899652 19:31907505-31907527 TTTTGAGATGGAGCCTTGCTCGG - Intergenic
1165074831 19:33274999-33275021 TTGGGGGATGGGGCGGTGCAGGG - Intergenic
1165491190 19:36123856-36123878 TTTTGAGATGGAGTCTTGCATGG - Intronic
1165826735 19:38709920-38709942 CTAGGAAATGGGGCAGTGCATGG - Intronic
1166121456 19:40689882-40689904 TTTTGAGAAGTGGCTGTGCCTGG + Intronic
1166203729 19:41255199-41255221 TTTTGAGATGGATCTGTGTAGGG + Intronic
1167038412 19:47008012-47008034 TTTACAGATGGGGCAGGTCAAGG - Intergenic
1167290142 19:48619948-48619970 TGGTGAGATGGGGCCTTGCAAGG + Intronic
927407804 2:22791904-22791926 GTTTGAAATGGGCCAGTGGAAGG - Intergenic
927448055 2:23183210-23183232 TTTAGAGATTGGGAAGGGCAGGG - Intergenic
928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG + Intronic
928858668 2:35829631-35829653 TTTTGAGATGGGACTTTACAGGG - Intergenic
928992757 2:37252234-37252256 TTTTTAGCAGGGCCAGTGCAGGG - Exonic
931301153 2:60979538-60979560 TTTTGAGATGGGGAGGTGGCGGG - Intronic
931369094 2:61645502-61645524 TTTTAAAATGGGGCTGGGCATGG + Intergenic
932012766 2:67994655-67994677 TTCTGAGATGGGGCAGGCCCTGG - Intergenic
934108208 2:88715863-88715885 TTTTGAGAAGGAGCTGTGAAAGG + Intronic
936609604 2:113988970-113988992 TTTTGAGATGGGGCTTTGAGAGG + Intergenic
936854479 2:116940038-116940060 TTTTTAGTTTGGGCAGTGGAGGG - Intergenic
937065822 2:119016846-119016868 TTTTTAAATGGGGCAAAGCAAGG - Intergenic
937159692 2:119748230-119748252 TTTTGAGATGGCTCACCGCATGG - Intergenic
937249791 2:120515986-120516008 TTTTGAGCCTCGGCAGTGCAGGG - Intergenic
937450373 2:121997523-121997545 TTTTGAGATGTGACAGGTCATGG + Intergenic
937987049 2:127642628-127642650 GGTTGAGATGGAGCAGTGGAAGG - Intronic
943382287 2:187166138-187166160 TTTTGAGAGGGGGAAGAGCAAGG + Intergenic
943406369 2:187492933-187492955 TTTTGAAATGTGCAAGTGCATGG + Intronic
944440661 2:199740277-199740299 TTTTGAGATGGAGCAGGGCCTGG + Intergenic
944827612 2:203501306-203501328 TTATCAGATGGGGCAGTGCCTGG + Intronic
946109463 2:217401584-217401606 TGTAGAGATGAGGGAGTGCAGGG - Intronic
946163456 2:217849646-217849668 TTTTGAGATGGGGTGGCGGAGGG - Intronic
947462639 2:230316787-230316809 TTTACAGATGAAGCAGTGCAGGG - Intergenic
947872524 2:233447357-233447379 TTTTGTGCTGGTGCAGTGCTGGG + Intronic
1168974436 20:1953450-1953472 TTATTATATGGTGCAGTGCAGGG + Intergenic
1169023776 20:2350037-2350059 TTTTGAGATGGGGCTGACCTGGG - Intergenic
1169119531 20:3086648-3086670 ATTAGAGATGGGGCCGAGCACGG - Intergenic
1169281232 20:4268517-4268539 TTTTGAGATGGGGCTTTGGGAGG - Intergenic
1169890189 20:10444148-10444170 TTTGGGGATGGGGAAGTACAAGG + Intronic
1170030708 20:11941143-11941165 TTGAAAGATGGGGCAGTGGAAGG + Intergenic
1170136152 20:13075685-13075707 TTTGGAGATGGGGCAGAGACTGG + Intronic
1175781482 20:61685084-61685106 TGTTGGGATGGGGCAGGGAATGG - Intronic
1176805123 21:13473751-13473773 TTTTGAGAAGTGGCTGTTCATGG - Intergenic
1177220709 21:18188791-18188813 TTTAGGAATGGGGCATTGCAAGG + Intronic
1177521196 21:22228507-22228529 TATTATGAAGGGGCAGTGCAGGG + Intergenic
1179521466 21:41948325-41948347 TTGTGAGCTGGGGCAGAGCCAGG - Intronic
1179809030 21:43858698-43858720 TTTTCTGAGGGGGAAGTGCATGG + Intergenic
1181484891 22:23224418-23224440 CTTTGAGATGGCTCAGAGCAAGG - Intronic
1181781506 22:25196913-25196935 TTGTAAGATGGGGCAGGGCGTGG + Exonic
1182737247 22:32539681-32539703 TTTGGAGATGGGCCAGCCCAAGG + Intronic
1184535070 22:45081245-45081267 AGTAGAGATGGGGCAGGGCATGG - Intergenic
1184638236 22:45853128-45853150 TTTTGCGAGGGGGCAGGGCAGGG - Intergenic
949601018 3:5597717-5597739 TTTTGCTGTGGGGCAGGGCAGGG + Intergenic
950437834 3:12991411-12991433 ATCTGAGATGCGGCAGTGCGTGG + Intronic
953598447 3:44338941-44338963 TTTTGAATTGAGGCAGTGCCAGG + Intronic
955272578 3:57516361-57516383 TTTTAAGATTAGGCAGTACATGG - Intronic
955525270 3:59813517-59813539 TTTTGAGAGGGGATAGAGCAAGG + Intronic
956729771 3:72185950-72185972 TTCTGAGATGTGGCATTGGAGGG + Intergenic
957399564 3:79691259-79691281 TTTTGGGAAGGGGCAGAGGATGG - Intronic
964718748 3:159750739-159750761 TTTGGTGATGGGGCAGTGGGTGG + Intronic
966569176 3:181421767-181421789 TGATTAGAAGGGGCAGTGCAGGG + Intergenic
966846949 3:184138096-184138118 CTTTGAGATGGGGAAGTGACAGG + Intronic
970074957 4:12207643-12207665 TGTTGAGATATGGCAGGGCAAGG - Intergenic
973962261 4:56123509-56123531 TTTGGAGATGGGGCTTTGGAAGG - Intergenic
976570451 4:86602141-86602163 TTTTTAGATGTTGCTGTGCATGG + Intronic
976757105 4:88510332-88510354 TTTTGAGATGTAGTAATGCATGG - Intergenic
976828014 4:89281855-89281877 TTTAGGGATGGGAAAGTGCAAGG - Intronic
976904209 4:90216418-90216440 TTTTGAGATAGTCCAGTGGATGG + Intronic
977119665 4:93082622-93082644 TTTAGAGATCGTGCAGTCCAAGG - Intronic
977547584 4:98402360-98402382 TTTAGAGATGAGGCCGGGCATGG - Intronic
983088095 4:163472243-163472265 TTTTGAGATTGGCCAGGCCAAGG - Exonic
983471677 4:168164081-168164103 TTTTGAGAGGTGGCAGGGAAAGG - Intronic
985754531 5:1705117-1705139 TCTTCAGATGTCGCAGTGCACGG - Intergenic
986363979 5:7011100-7011122 TTCTGAGATGGGAAGGTGCAGGG + Intergenic
990755380 5:59063590-59063612 TTTTGAGATGGGTCAGGGCCAGG + Intronic
992145145 5:73839419-73839441 TTTAGAGATAGAGCAGTGAAGGG - Intronic
992985964 5:82229976-82229998 TTTTCAGATTGACCAGTGCAGGG - Intronic
994871470 5:105355122-105355144 TCTTGAGATGGGTCAGACCATGG + Intergenic
995121093 5:108536003-108536025 ATGTGGGATGGGGCAGTCCAGGG - Intergenic
995965311 5:117899614-117899636 TTTTTAGATGGTGCAGGGAAGGG + Intergenic
997973603 5:138424947-138424969 TTTTAAGATGGGGCAGAGAAGGG + Intronic
999009520 5:148020514-148020536 ATTGAAGATGTGGCAGTGCATGG + Intergenic
999233753 5:150078349-150078371 ATTTGGGATGGGGCAGTGATGGG - Intronic
999425091 5:151480964-151480986 TATTGAGCTGGGGCAGTGACAGG + Intronic
999460176 5:151750941-151750963 TTTTTAAATGGGGCTGGGCACGG - Intronic
1001501878 5:172243364-172243386 TTTGGAGATGGGGCACTGAATGG + Intronic
1004605287 6:17188941-17188963 TTGTGAAATGGGGTACTGCAGGG + Intergenic
1004649408 6:17594066-17594088 TTTTGAGATGGAGTCTTGCACGG - Intergenic
1005117998 6:22359465-22359487 TGTTGAGAGGGAGAAGTGCAGGG + Intergenic
1005920378 6:30396295-30396317 TTCTGACATGCGGCAGTGGAAGG + Intergenic
1006591844 6:35163949-35163971 TTTTCAGATGGAGCAGAGCAGGG - Intergenic
1006888433 6:37401854-37401876 TTATGAGATAAGCCAGTGCAAGG - Intergenic
1009747671 6:67839611-67839633 TTTTCATATGGGTGAGTGCAAGG - Intergenic
1011889477 6:92139300-92139322 TTCTGAGATGAGGCAGGTCAGGG + Intergenic
1012413016 6:98981121-98981143 TTTTTAAATGGGGCAAAGCAAGG - Intergenic
1017718933 6:157231468-157231490 CTTTAGGAGGGGGCAGTGCAGGG + Intergenic
1019157323 6:170048039-170048061 TCTGGAGATGGGGAAGTCCAAGG - Intergenic
1019448293 7:1082721-1082743 TTACGAGATGGGGCAGTGGCAGG - Intronic
1020049705 7:5073236-5073258 TTTTGGGATGGGCCCGTGCCTGG + Intergenic
1022490516 7:30813899-30813921 TTTCATGATGGGGCAGTGTAGGG + Intronic
1023449201 7:40264298-40264320 TTTATAGATGAGGCAGTGGAAGG + Intronic
1023848430 7:44137093-44137115 TTTAGAGTTGTGGCAGGGCACGG + Intergenic
1023857851 7:44196031-44196053 TTTTGTGATGTGTCAGTGCTGGG + Intronic
1025730651 7:64103836-64103858 TTCTGAGATGAGGCCTTGCACGG + Intronic
1026230952 7:68483739-68483761 TTTTTAGATGGAGCATTGCTGGG + Intergenic
1026553143 7:71385033-71385055 GATTGGGGTGGGGCAGTGCATGG + Intronic
1027880959 7:83835707-83835729 CATTCAGATGGGGAAGTGCATGG + Intergenic
1028225577 7:88248694-88248716 TCTTGAGACAGGGCAGGGCATGG - Intergenic
1028976879 7:96924451-96924473 TTCTGAAATGGGGCTGGGCACGG + Intergenic
1029194760 7:98797481-98797503 TTTGCAGATGGGGCAGAGCAAGG + Intergenic
1033608275 7:142943160-142943182 GTTTGAGGTGGGGCAGTCCTGGG - Intronic
1034333485 7:150304675-150304697 TTTTGAGATGGGGCAGTGCATGG - Intronic
1034409562 7:150932888-150932910 TTTTGAAATGGGGCTGGGCACGG + Intergenic
1034664558 7:152805215-152805237 TTTTGAGATGGGGCAGTGCATGG + Intronic
1035813346 8:2512159-2512181 CTCTGAGATAAGGCAGTGCAGGG + Intergenic
1037659478 8:20914497-20914519 TTTTGATCTGGGGCAGAGGAGGG - Intergenic
1037990636 8:23319337-23319359 TTTGGAGAGGGGGCAGTGGGAGG + Intronic
1042334699 8:67617897-67617919 TCTTGCCATGGGGCAGTTCACGG + Intronic
1043131816 8:76472219-76472241 TCATGAGATCGGGCAGGGCATGG + Intergenic
1043369554 8:79575073-79575095 CGTTGAGATGGGGCAAAGCAGGG + Intergenic
1045065557 8:98440765-98440787 TTTTGAGAAAGGGAAATGCACGG - Intronic
1045180810 8:99779925-99779947 TTTTGGGATGGAGCAGTTAAGGG + Intronic
1046658642 8:116924582-116924604 TTATGAGATGAACCAGTGCAAGG - Intergenic
1047317819 8:123750622-123750644 TTTTGAGCGGGGGCAGTGGGCGG + Intergenic
1047346698 8:124035613-124035635 TTTTTAGATGGGACAATGAAAGG - Intronic
1047532400 8:125688867-125688889 TTTGGAGGTGGGGAAGTCCAAGG + Intergenic
1048199466 8:132359841-132359863 TTGGCAGATGTGGCAGTGCATGG - Intronic
1048819882 8:138370738-138370760 ATTTTACATGGGGCAGAGCATGG - Intronic
1049263429 8:141652281-141652303 GTGTGAGCTGCGGCAGTGCACGG + Intergenic
1051418038 9:16863201-16863223 TATTGAGATGGGGCAGGGCGTGG - Intronic
1053156541 9:35784756-35784778 TATAGAGATAGGGCAGGGCACGG - Intergenic
1057424526 9:94937475-94937497 TTTGGAGATAGGGCAGTTGAGGG - Intronic
1058675825 9:107399186-107399208 TTTTGAGATGGAGTCTTGCACGG + Intergenic
1059215965 9:112562426-112562448 ATGTGAGCTGGGACAGTGCAGGG - Intronic
1059252775 9:112902119-112902141 TCCTGAGAAGGGGCAGTGAAGGG + Intergenic
1059466888 9:114474591-114474613 TTTGGACATGTGGCAGTGGAAGG - Intronic
1059476450 9:114551584-114551606 TGTAGAGATGGGGCAGAGGAGGG + Intergenic
1060103709 9:120860785-120860807 TTTTCAGATGGGCTAGGGCAAGG + Intronic
1060524654 9:124313730-124313752 TTTTGTGGTGGGACAGTGCTGGG + Intronic
1060747934 9:126149897-126149919 TGTCGAGAGGGGGCAGTGCCAGG + Intergenic
1061196230 9:129108575-129108597 CTTTGAGATGGGGCAGGGGTGGG + Intronic
1062122459 9:134841128-134841150 TTTGGGGATGGGGCAGTGGAAGG + Intronic
1186984503 X:14997295-14997317 TTTGGAGATGGGGTACTTCAGGG - Intergenic
1187148198 X:16656898-16656920 TTTTGAGATAGGGTATTGCTCGG + Intronic
1187431889 X:19232579-19232601 TTTTGAGAGGGGGCAGTTACAGG + Intergenic
1187703270 X:21984932-21984954 TTTTGAGAGCGAGCAGTGCTAGG + Intronic
1188811958 X:34661630-34661652 TTGTGTGATGTGACAGTGCAGGG - Intergenic
1189404595 X:40709096-40709118 TTATGAAATGGGGCTGGGCATGG - Intronic
1189572704 X:42316012-42316034 GTCAGAGATGGGACAGTGCAAGG + Intergenic
1189897454 X:45670278-45670300 ATTTGAGATGAGGCAGGGGAGGG - Intergenic
1190741507 X:53291845-53291867 TTGGGAGATGGGGCAGGGCCTGG - Intronic
1191645384 X:63475094-63475116 TTATGAGATAAGCCAGTGCAAGG + Intergenic
1194214153 X:91108210-91108232 TATTGAGATGTGGCCGGGCACGG + Intergenic
1196245461 X:113393876-113393898 TCTTTAAATGGGGCTGTGCAGGG - Intergenic
1196752184 X:119127994-119128016 TTTTGAAATGTAGCACTGCAGGG + Intronic
1197082661 X:122438917-122438939 TTGTGACTTGGGGCAGTGTATGG + Intergenic
1197184125 X:123567748-123567770 TTTTGAGAAGTGTCAGTTCATGG - Intergenic
1198563789 X:137882292-137882314 TTTTGTGATGCTGCAGTGCCTGG - Intergenic
1198971070 X:142280834-142280856 ATCTGAGATGGGCCAGTGCTAGG + Intergenic
1199395385 X:147330941-147330963 TTTTGAGAGTGGGTAGTGTAAGG - Intergenic
1199565588 X:149212333-149212355 TTTTCAGATGAGGAAGTGGAGGG + Intergenic
1200355251 X:155542589-155542611 TTTTGAAATTGGGAAGTGCGAGG - Intronic