ID: 1034666559

View in Genome Browser
Species Human (GRCh38)
Location 7:152822854-152822876
Sequence GGTCCCAGCACGCCACAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034666559_1034666568 17 Left 1034666559 7:152822854-152822876 CCGGCTTGTGGCGTGCTGGGACC 0: 1
1: 1
2: 0
3: 6
4: 85
Right 1034666568 7:152822894-152822916 AGCCGCTGCAGTCAGGTTTAGGG 0: 1
1: 0
2: 1
3: 2
4: 72
1034666559_1034666566 10 Left 1034666559 7:152822854-152822876 CCGGCTTGTGGCGTGCTGGGACC 0: 1
1: 1
2: 0
3: 6
4: 85
Right 1034666566 7:152822887-152822909 CCAAAGAAGCCGCTGCAGTCAGG 0: 1
1: 0
2: 2
3: 8
4: 129
1034666559_1034666567 16 Left 1034666559 7:152822854-152822876 CCGGCTTGTGGCGTGCTGGGACC 0: 1
1: 1
2: 0
3: 6
4: 85
Right 1034666567 7:152822893-152822915 AAGCCGCTGCAGTCAGGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034666559 Original CRISPR GGTCCCAGCACGCCACAAGC CGG (reversed) Intronic
900466464 1:2827915-2827937 GGTCTCAGCAACCCACGAGCAGG - Intergenic
901453339 1:9349364-9349386 GGCCCCATCGTGCCACAAGCAGG - Intronic
902640825 1:17765076-17765098 GGTACCATCTCCCCACAAGCTGG - Intronic
903212122 1:21824246-21824268 GGTCCCAGCACCCCACCCCCCGG - Exonic
906537094 1:46557044-46557066 GTGCCCAGCAGCCCACAAGCAGG - Intergenic
907333897 1:53688120-53688142 GGTGTCAGCACGCCACACACAGG - Intronic
910704966 1:90119050-90119072 GTTCCCAGCACACCCCAACCAGG - Intergenic
915332927 1:155124888-155124910 GCTCCCAGCACGTCACCCGCAGG - Intergenic
917046058 1:170861436-170861458 GGTCCCAGCAGGCCAAAGGTTGG + Intergenic
918271939 1:182910365-182910387 GGTGCCAGCAGGCCACCAGGTGG + Intronic
918811144 1:189122698-189122720 GTTCCCAGCAGGCCACAGGCTGG - Intergenic
919064281 1:192673751-192673773 GGTGCCACCACGCCATAAGTGGG + Intergenic
921165476 1:212503824-212503846 GGTCCTAGCACAACCCAAGCTGG - Intergenic
922740964 1:228014032-228014054 GGTCCCAGGAGGCGACCAGCTGG + Intronic
922791501 1:228313716-228313738 GGTCCCATCCAGCCACCAGCGGG - Intronic
1065521113 10:26573856-26573878 GGGCACAGCACACCACAAGGGGG + Intergenic
1067106633 10:43371064-43371086 GGTCCCAGAACCCCCAAAGCTGG + Intergenic
1069757625 10:70782783-70782805 GGTCCCAGCAGGCCTCCAGTGGG - Intronic
1069916767 10:71791350-71791372 GGCCCCAGCACCCCACAACCAGG + Intronic
1070087765 10:73253222-73253244 GATCACAGCACGGCAAAAGCAGG - Intergenic
1073360399 10:102893993-102894015 GGTCCCACCAAGGCACAAGATGG + Intronic
1084303760 11:68268004-68268026 CGTCCCATCACCCAACAAGCAGG + Intronic
1085266781 11:75242066-75242088 GGTCCCGGCACGCCTCGCGCAGG - Exonic
1089104474 11:115990748-115990770 GGTCCCAGCTCCCCAGCAGCTGG - Intergenic
1094298570 12:28935592-28935614 GGTCCCAGAATGCCCTAAGCTGG + Intergenic
1104747022 12:131216906-131216928 GGACCCAGCACGGCACAGGAGGG + Intergenic
1104785596 12:131446279-131446301 GGACCCAGCACGGCACAGGAGGG - Intergenic
1106499202 13:30310868-30310890 AGTTCCAGCACTGCACAAGCAGG + Intergenic
1112287305 13:98115731-98115753 GGTCCGAGCAAACAACAAGCCGG + Intergenic
1112412849 13:99178921-99178943 ACTCCCAGCCCGCCACCAGCTGG + Intergenic
1117460452 14:55939885-55939907 GGTCCCTGCAAGCCAGAAGAAGG + Intergenic
1139650076 16:68357815-68357837 GGTCCTGGCAGGCCACCAGCTGG - Exonic
1141319149 16:82990410-82990432 GGTCCCAGCCCATCACAAGATGG - Intronic
1142737746 17:1912254-1912276 GGTCCCAGGGCGCCAGCAGCTGG - Intergenic
1143376064 17:6468416-6468438 GGGCCCAGCTGGCCACAAGCTGG - Intronic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1146926453 17:36749229-36749251 CCTCCCAGCGCCCCACAAGCTGG + Intergenic
1147139641 17:38453915-38453937 GGCCCCAGTACGCCCCAGGCCGG - Intronic
1148547418 17:48528795-48528817 GCCCCCAGCAAGCCACAACCAGG - Exonic
1150765895 17:68002014-68002036 GGTCTCAGCTCACCGCAAGCTGG + Intergenic
1152244108 17:79176375-79176397 GCCCCCAGCACCCCCCAAGCAGG + Intronic
1152792109 17:82286430-82286452 GGTGCCAGCACGCCACACCAAGG + Intergenic
1153488996 18:5629459-5629481 GCGCCCCCCACGCCACAAGCCGG + Intronic
1154375957 18:13810073-13810095 GGTGCCTGCACTCCACAGGCAGG + Intergenic
1155202338 18:23528078-23528100 GGTCCCTGCATCCCACGAGCTGG + Intronic
1160560340 18:79752040-79752062 CGTCCCAGCACGGCACCAGGAGG + Intronic
1161324487 19:3656865-3656887 GCTCCCAGCACCCCTGAAGCTGG + Intronic
1166357659 19:42236578-42236600 GGTCCCAGCAGCCCACCTGCTGG + Intronic
1167072668 19:47230150-47230172 GGTCCACCCACCCCACAAGCAGG + Intronic
1168728535 19:58606329-58606351 CGTCGCTGCACGCCACATGCAGG - Intergenic
925753874 2:7115025-7115047 GGTCTCAGCACACCCCAGGCAGG - Intergenic
926712822 2:15896307-15896329 GTGCCCAGCAAGCCCCAAGCAGG + Intergenic
929573892 2:43040271-43040293 GGCCCCACCACGCCACCAGTGGG + Intergenic
937099194 2:119255589-119255611 GCTATCAGCACTCCACAAGCTGG + Intronic
940289913 2:152068396-152068418 GGTCCCGGCACAGCCCAAGCAGG + Intronic
944679498 2:202064269-202064291 GTTCCCAGCCAGCAACAAGCTGG - Intergenic
947218727 2:227772514-227772536 GTTCCCAGCAGGCCACAGACTGG - Intergenic
948485508 2:238278551-238278573 TTTCCCAGCACCCCACAGGCCGG - Intronic
948825327 2:240571086-240571108 GGTCCCAGCCCCCCCCAAGGGGG + Intronic
1171283854 20:23922167-23922189 TGTCCCAGCAGACCACAACCTGG - Intergenic
1176191220 20:63811087-63811109 GGTCCCAGAACCCCACAGGATGG + Intronic
1176191263 20:63811213-63811235 GGTCCCAGAACCCCACAGGATGG + Intronic
1178550783 21:33537343-33537365 GGACCCAACAAGCCACAAACTGG - Intronic
1183672614 22:39282054-39282076 GGTCCCAGCACTCAGGAAGCTGG - Intergenic
950882670 3:16335872-16335894 GGTCTCAGGAGGCCACAGGCAGG + Intronic
958472138 3:94534049-94534071 GGACCCAGCACACTACAAACAGG - Intergenic
964195524 3:154059795-154059817 GGTCCCAGCATGCCTGAGGCAGG - Intergenic
967101600 3:186220642-186220664 GGTCCCAGCCAACCTCAAGCTGG - Intronic
972027654 4:34405536-34405558 GATCCTAGCAGGCCACAGGCTGG + Intergenic
980360024 4:131750173-131750195 CGTCCCCGCACGCCTCAGGCTGG - Intergenic
989444399 5:41510552-41510574 GGTCCCAGCACTCCTCGGGCAGG + Exonic
992846241 5:80751538-80751560 GGTGCCAGCACACCACCAGCAGG - Intronic
994082144 5:95718867-95718889 GGTCCCAGGAGAGCACAAGCAGG + Intronic
1004333560 6:14743347-14743369 GGTCCCAGCAGGCCTCCAGATGG + Intergenic
1006837452 6:37007562-37007584 GGTCCCAGCAGGCATCAAGAGGG + Intronic
1007108036 6:39296750-39296772 GGTCCCACCATGCCAGGAGCAGG - Intergenic
1009029063 6:58035179-58035201 GGTCCCAGCACCACATGAGCAGG - Intergenic
1009204603 6:60786577-60786599 GGTCCCAGCACCACATGAGCAGG - Intergenic
1020261128 7:6531287-6531309 GGTCCCAGCAGGGCAGAGGCGGG - Intronic
1021894759 7:25223362-25223384 GGTCTTAGCAAACCACAAGCAGG - Intergenic
1032403291 7:131638433-131638455 GGTCCCAGGACTCCACAGTCAGG + Intergenic
1034331484 7:150287007-150287029 GGTCCCAGCATGCCACAAGCCGG + Intronic
1034536148 7:151727287-151727309 GGTCCCAGTCCCCCACAGGCAGG - Intronic
1034666559 7:152822854-152822876 GGTCCCAGCACGCCACAAGCCGG - Intronic
1035224659 7:157426635-157426657 TGTCCCTGCTCGCCACCAGCTGG - Intergenic
1043781305 8:84339250-84339272 GTTCCCAACAGGCCACAAACTGG - Intronic
1049109457 8:140634517-140634539 GGTGGGAGCACGCCAAAAGCAGG + Intronic
1060176281 9:121499603-121499625 GGTCCCCGGAGGCCACGAGCAGG - Intergenic
1061331981 9:129900499-129900521 GCTCCCAGCACGCAGCGAGCAGG - Exonic
1062039320 9:134396836-134396858 GGTCTGAGCAGGCCACAGGCTGG - Intronic
1062518368 9:136947151-136947173 GGTCCCAGCAGGGCACAAGATGG - Intronic
1187191399 X:17038672-17038694 AGTCCCAGCACTGCACAAGCTGG - Intronic
1196825686 X:119738501-119738523 AGTCCCATCACTCCAAAAGCTGG + Intergenic