ID: 1034667985

View in Genome Browser
Species Human (GRCh38)
Location 7:152834970-152834992
Sequence TCTCCTGGATGACGTTCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 2, 1: 0, 2: 2, 3: 12, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034667985_1034667988 14 Left 1034667985 7:152834970-152834992 CCGCCAGAACGTCATCCAGGAGA 0: 2
1: 0
2: 2
3: 12
4: 165
Right 1034667988 7:152835007-152835029 ACACTGTATCAAAAGTGATAAGG 0: 2
1: 0
2: 1
3: 12
4: 181
1034667985_1034667989 15 Left 1034667985 7:152834970-152834992 CCGCCAGAACGTCATCCAGGAGA 0: 2
1: 0
2: 2
3: 12
4: 165
Right 1034667989 7:152835008-152835030 CACTGTATCAAAAGTGATAAGGG 0: 2
1: 0
2: 1
3: 14
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034667985 Original CRISPR TCTCCTGGATGACGTTCTGG CGG (reversed) Intronic
900669127 1:3838960-3838982 CCTCCTGGATGCCGAGCTGGTGG - Exonic
901179620 1:7332280-7332302 CCTCCTGGATGACATTCTGGAGG - Intronic
901379948 1:8866351-8866373 TCTCCTTGATGACATTCTTCAGG + Exonic
903006516 1:20302488-20302510 TCTCCTGCCTCAAGTTCTGGGGG + Intronic
903885440 1:26538317-26538339 TCTCAGGGCTGAGGTTCTGGGGG + Intronic
904127857 1:28254519-28254541 TCTCATGGATGACTTTGAGGTGG + Intergenic
904702073 1:32363647-32363669 ACACCTGGATGATGTTCTTGTGG - Exonic
906719187 1:47993447-47993469 TCTCCTGGCTGACTTTCTCCTGG + Intronic
908439276 1:64137152-64137174 GCTTCAGGATGACTTTCTGGGGG + Intronic
908629267 1:66084581-66084603 TCTACTGGATGAGTTTCTTGGGG - Intronic
910718795 1:90261706-90261728 TCTCATGGATGACTTTGAGGGGG + Intergenic
910771080 1:90833411-90833433 GCTTCTGGATGGCTTTCTGGTGG - Intergenic
917424569 1:174900860-174900882 TCTCCTGGATGATATCCTGAAGG + Intronic
919845619 1:201640341-201640363 CTTCCTGGATGAGGTCCTGGAGG + Intronic
922046715 1:221952201-221952223 TGTCCTGGATGCTGGTCTGGTGG - Intergenic
923723066 1:236483737-236483759 TCTCCTTGATGACATTCTTCAGG - Intronic
1068579949 10:58728509-58728531 TCTCATGGATGACTTTGAGGGGG - Intronic
1072254012 10:93602971-93602993 TCTCCTAGAACACATTCTGGTGG + Intronic
1072863754 10:99035444-99035466 TCTTCTGGAATACCTTCTGGAGG + Intronic
1075612864 10:123867497-123867519 TCTCTAGGATGACGCTCTGAAGG - Intronic
1078834663 11:15015769-15015791 TCTCCTGGATGATATCCTGCTGG - Intronic
1079193834 11:18306267-18306289 TTTCCTGGAAGATGTTCTGGGGG - Exonic
1080981135 11:37407652-37407674 TTTGTTGGATGACTTTCTGGAGG + Intergenic
1081423858 11:42903554-42903576 TCATGTGGATGACCTTCTGGTGG - Intergenic
1081466699 11:43325856-43325878 TTTGCTGGTTGACATTCTGGAGG + Intronic
1084856160 11:71988320-71988342 TTTCCTGGATGAAATACTGGTGG + Intronic
1085702441 11:78756917-78756939 TCTCCTGGATGATGTCCAGAGGG + Exonic
1086526269 11:87729900-87729922 TCTACTGGCTGAAGTTCTGTTGG - Intergenic
1087121386 11:94578042-94578064 TCTGCTTGTTGACTTTCTGGAGG - Intronic
1090048773 11:123359058-123359080 TCTCCTCCATGAATTTCTGGAGG + Intergenic
1090770067 11:129912135-129912157 GCACCTGGATGGCGTGCTGGGGG + Exonic
1090871955 11:130756977-130756999 GCTCCTGGAGGAGGTTCTGGAGG + Intergenic
1090944982 11:131421503-131421525 GTTCCTGGATGCCTTTCTGGAGG - Intronic
1091354435 11:134924737-134924759 TCTCCTGGATGAGATGCTGGAGG - Intergenic
1091557399 12:1584654-1584676 TCAGCTGGATGAAGTTCAGGGGG + Intronic
1092711686 12:11344746-11344768 TTTGCTGGTTGACTTTCTGGAGG + Intergenic
1093318678 12:17684593-17684615 TATCCTGGATAATATTCTGGAGG - Intergenic
1095186760 12:39209304-39209326 TCTCCTGGATAATGTCCTGAAGG - Intergenic
1095936767 12:47692371-47692393 TCTTCTGGATAACTTTCTGCAGG + Intronic
1097178035 12:57154674-57154696 TGCCCTGGATGATGGTCTGGCGG - Exonic
1100908216 12:99326267-99326289 TTTCCTTGTTGACTTTCTGGAGG + Intronic
1105826271 13:24126186-24126208 TCTCCAGGATGAAGTCATGGGGG + Intronic
1108463850 13:50694913-50694935 TCTAGTGGATGAGGTCCTGGAGG + Intronic
1116602851 14:46949264-46949286 TCTTCTGGATGATGTACTGTGGG - Intronic
1118483207 14:66188297-66188319 TCTCCTGGATAATGTCCTGCAGG + Intergenic
1120847765 14:89141046-89141068 TTTGCTGGTTGACTTTCTGGAGG - Intronic
1121027350 14:90626392-90626414 TCCCCTGGATCACATTCTGAAGG + Intronic
1122713775 14:103680835-103680857 CCTCTTGAATGAAGTTCTGGAGG + Intronic
1126452413 15:48823312-48823334 GCTCCTTGATGCAGTTCTGGAGG - Intergenic
1128565772 15:68699716-68699738 TCTCCTGGAGGACGTGCTCTGGG + Intronic
1132384416 15:101390091-101390113 TCTTCAGGAGGACGTCCTGGTGG - Intronic
1132842526 16:1984995-1985017 GCTCCTGGCTGACGTTATAGCGG + Intronic
1135582448 16:23640254-23640276 TATCCTGGCTTACCTTCTGGTGG - Intronic
1135587247 16:23680221-23680243 TTTCCTGAATGAAGATCTGGAGG + Exonic
1136226440 16:28863604-28863626 CCTCCGGGAGGACGCTCTGGTGG + Intronic
1138064315 16:53924774-53924796 TCTCCCGGAGGAGGTTTTGGGGG - Intronic
1139114381 16:63931735-63931757 TTTGCTTGATGACTTTCTGGAGG + Intergenic
1139902464 16:70339010-70339032 GCTCATGGAGGAAGTTCTGGTGG - Intronic
1141017907 16:80467511-80467533 TCTTTTGGATGAGGTTATGGTGG + Intergenic
1142800446 17:2341744-2341766 TCCCATGTATGAGGTTCTGGTGG - Intronic
1143907945 17:10224801-10224823 TCTCTTGGAAGACTTTCTGGAGG + Intergenic
1147703740 17:42412019-42412041 TCTCCCGGATCCCGTTCTGTGGG - Intronic
1148835237 17:50462474-50462496 GCTCCTGGATGAAGTGGTGGCGG + Exonic
1150266104 17:63833327-63833349 ATTCCTGGATGAAGTCCTGGGGG + Exonic
1150327955 17:64271890-64271912 TCTCCTGGATTACTTGCTTGGGG + Intergenic
1152293848 17:79455374-79455396 CCTCCTGGATGACCCTCAGGTGG - Intronic
1152836875 17:82538947-82538969 TCTCCTGGTTTATCTTCTGGTGG + Intronic
1152918201 17:83052549-83052571 CCTCCTGGAGGACCTCCTGGTGG - Intergenic
1157359690 18:46965541-46965563 TCTGCTGGTTGACTTTCTGCAGG - Intronic
1157361283 18:47025060-47025082 TCTGCTGGTTGACTTTCTGCAGG - Intronic
1157362273 18:47030975-47030997 TCTGCTGGTTGACTTTCTGCAGG - Intronic
1159645634 18:70915334-70915356 TCTCCTGGATAACACCCTGGAGG + Intergenic
1159764074 18:72465237-72465259 TTTTCTTGATGACTTTCTGGAGG - Intergenic
1162175061 19:8824184-8824206 TCTCCTGGATGTTGCTCTAGAGG + Exonic
1162308231 19:9888664-9888686 ACTCCTGCCTGACGTTCTGGAGG - Intronic
1165090894 19:33387952-33387974 CCTCCTGGATGAGGCCCTGGCGG - Exonic
1165686586 19:37826707-37826729 TCTTCTGGATCACATGCTGGAGG - Intergenic
1165706215 19:37978013-37978035 TCTCCAGGATGAGGTTCAGAGGG + Intronic
1165784441 19:38452990-38453012 CCTCCTGGAAGAGGCTCTGGCGG - Exonic
1165789487 19:38483074-38483096 CAAACTGGATGACGTTCTGGTGG - Exonic
1166090306 19:40504075-40504097 TCTCCTGGAAGACCTTCTGCAGG - Exonic
1166154153 19:40898274-40898296 TGTCCTGGATGATGTTGTGGGGG - Exonic
1166173954 19:41052306-41052328 TGTCCCGGATGAGGTTGTGGGGG + Intergenic
1167043978 19:47039397-47039419 TCACGTGGATGACCTGCTGGTGG - Exonic
1167471932 19:49680266-49680288 TCCCCTGGATGGTGCTCTGGGGG + Intronic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
925072673 2:983490-983512 CCTCCTGCATGACTTTCAGGGGG + Intronic
925764825 2:7222283-7222305 TTTCCTTGTTGACTTTCTGGAGG - Intergenic
935168715 2:100592592-100592614 CCTCCTGGATGACTTTGAGGGGG - Intergenic
937284960 2:120744780-120744802 CCTCCTGGATGAGATTCAGGTGG + Intronic
937910043 2:127071089-127071111 CCTCCGAGATGACGTGCTGGAGG + Intronic
937953983 2:127408730-127408752 TCTCCAGGAAGACTTCCTGGAGG - Intergenic
940516853 2:154694180-154694202 CTTCCAGGATGAGGTTCTGGAGG - Intergenic
943618889 2:190125067-190125089 CCTCCTGAAGGACCTTCTGGAGG + Intronic
945690825 2:213033271-213033293 CCTCATGGATGACTTTCAGGAGG - Intronic
947754881 2:232554855-232554877 TCTCCTGGATGAAATGCTGAGGG + Intronic
947908982 2:233789532-233789554 CCTGCTGGATGATGTCCTGGAGG - Exonic
948919483 2:241055275-241055297 GCTCCTGTCTGACGTTCTGTGGG - Intronic
1170528242 20:17262528-17262550 TTTCCTGCATGATGTTCTCGTGG + Intronic
1173776880 20:45715908-45715930 TCTCCTGGATGATATCCTGAAGG - Intergenic
1177260041 21:18717911-18717933 TCTTCTTGTTGACTTTCTGGTGG + Intergenic
1177332142 21:19678689-19678711 TCTCCTGGATGATATCCTGAAGG + Intergenic
1178241914 21:30912519-30912541 TCTCATTGATGAATTTCTGGAGG + Intergenic
1178789450 21:35686417-35686439 TCTGCTTGTTGACTTTCTGGAGG + Intronic
1180206812 21:46265858-46265880 GCTCCTGGGAGGCGTTCTGGTGG + Intronic
1183401381 22:37607065-37607087 TCTCCTGGATGAGGTTACTGCGG + Intergenic
1183577218 22:38699846-38699868 TGTCCTGGAAGACGTTATTGAGG + Exonic
1185293276 22:50039489-50039511 TCTCCTGGTTGAGGTTCGTGGGG - Intronic
953381728 3:42477414-42477436 TCTCCTGGATGGAGCTCTGTAGG - Intergenic
954388504 3:50256930-50256952 TCTCATGCATGCGGTTCTGGGGG - Exonic
955277189 3:57557369-57557391 CCTTCTGGATAAGGTTCTGGCGG - Exonic
959281026 3:104340573-104340595 ACTCATGGATGACATTGTGGGGG - Intergenic
961643388 3:128379199-128379221 TCTCCTGGAAGCCGTCCTGACGG + Intronic
962185868 3:133258792-133258814 TCTCTTGGATAACGTTCTTCAGG - Intronic
962989298 3:140564052-140564074 TCTCCTGGATGAAGTGCTGGTGG - Exonic
965813201 3:172612995-172613017 TCTGCTTGTTGACTTTCTGGAGG - Intergenic
967481128 3:189974593-189974615 TCTCCTGGATAACGTCCTGTCGG - Exonic
967981551 3:195068919-195068941 TCTCCTGCATGTCCTTGTGGTGG + Exonic
968655334 4:1776108-1776130 TTTCCTGGAGGACTTCCTGGTGG - Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
968763074 4:2452292-2452314 TCTCCTGCATGAGGCTCTGCCGG - Exonic
968903490 4:3441709-3441731 TATCCTGGAAGACTTCCTGGAGG + Intergenic
969043725 4:4321249-4321271 TCTCCAGCATGACTCTCTGGGGG + Exonic
969916026 4:10492456-10492478 TCACAGGGATGACGTTCTGTTGG + Intronic
976398585 4:84583211-84583233 TCTCGTTGATGCCGTTTTGGAGG + Exonic
977183228 4:93903914-93903936 TCTCCTGGATGTAGTGCTGCTGG - Intergenic
977668884 4:99672382-99672404 TCTCCTGGATGATATACTGACGG - Intergenic
978138741 4:105294170-105294192 GCTCCTGGATGCCATGCTGGAGG - Intergenic
982725521 4:158902399-158902421 TCTCCTGTATGAGGTTCTGTCGG + Intronic
985013345 4:185606748-185606770 TCTCCTTCCTGAGGTTCTGGCGG + Intronic
993453177 5:88097457-88097479 TCTGCTGGATCACCTTCTGCAGG + Intergenic
995415145 5:111902620-111902642 TTTCCTTGTTGACTTTCTGGAGG + Intronic
999407468 5:151319676-151319698 TCTGCTGGAAGTAGTTCTGGAGG - Intronic
1002864024 6:1105440-1105462 TGTTCTGAAGGACGTTCTGGAGG - Intergenic
1006798548 6:36745500-36745522 TCTCCTGGTTGCCATTCTGGGGG + Exonic
1008996096 6:57661052-57661074 ACTCCTGCATGACTTTCTGAAGG - Intergenic
1009184625 6:60559828-60559850 ACTCCTGCATGACTTTCTGAAGG - Intergenic
1009742751 6:67768681-67768703 ACTCCTGGATGACAGACTGGTGG + Intergenic
1015291247 6:131540132-131540154 TCTCCTGGATAACATCCTGAAGG - Intergenic
1016397422 6:143640323-143640345 TCTTCTGGAATACCTTCTGGAGG - Intronic
1017525819 6:155240658-155240680 GCTCCTGGATGACTTTGCGGAGG - Exonic
1019861137 7:3659184-3659206 TTTCCTGGACTACGTTCTGTGGG + Intronic
1020698036 7:11440576-11440598 TCTCATGGATGACTTTGAGGGGG + Intronic
1023029102 7:36077632-36077654 TCTCCTGGAGGCCGATCTGCTGG - Intergenic
1024319040 7:48047029-48047051 TCTTCTGTATGAAGTCCTGGTGG + Intronic
1024633170 7:51265597-51265619 TCTCCTGGTTGGGGTTCTGTGGG - Intronic
1025264355 7:57442775-57442797 TGTCCTGAATCACATTCTGGTGG + Intergenic
1025634859 7:63313332-63313354 TGTCCTGAATCACATTCTGGTGG - Intergenic
1025647836 7:63434838-63434860 TGTCCTGAATCACATTCTGGTGG + Intergenic
1028035102 7:85972303-85972325 TCTTCTGGACGACCTACTGGTGG - Intergenic
1030547405 7:110914021-110914043 TTTGCTGGTTGACTTTCTGGAGG - Intronic
1030737140 7:113062634-113062656 TTTGCTGGTTGACTTTCTGGAGG + Intergenic
1031799484 7:126224070-126224092 TCTCCTGGCTGCCTTTCTGAAGG + Intergenic
1033506388 7:142006456-142006478 TTTCCTTGTTGACTTTCTGGAGG - Intronic
1034330069 7:150274888-150274910 TCTCCTGGATGACGTTCTGGCGG + Intronic
1034667985 7:152834970-152834992 TCTCCTGGATGACGTTCTGGCGG - Intronic
1036453710 8:8891372-8891394 TCTCCTGCAGGGCGATCTGGCGG + Exonic
1036907661 8:12720595-12720617 TCTTCTGGATGACCTGCTTGTGG + Intergenic
1042449773 8:68930906-68930928 TCTCCTGGATGACTTTCCTTGGG + Intergenic
1044826239 8:96200250-96200272 TCTGCTTGTTGACTTTCTGGAGG + Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045237631 8:100368382-100368404 TTTGCTGGTTGACTTTCTGGGGG + Intronic
1045970228 8:108071759-108071781 GCTTCTTGATGACGTTCTAGAGG - Intronic
1051292605 9:15560296-15560318 TCTCCTGGATGATATCCTGAAGG + Intronic
1052040819 9:23736780-23736802 TCTCCTGGACAATGTTTTGGTGG - Intronic
1052956248 9:34255212-34255234 TCTCCTGGGTAGCTTTCTGGAGG + Intronic
1056036135 9:82607834-82607856 ACTCTTGGATGACATTCTGCTGG - Intergenic
1056442217 9:86632602-86632624 ACTCCTGGGTGATGTTCTCGGGG + Intergenic
1057229908 9:93314969-93314991 TCTGCTTGCTGACTTTCTGGAGG - Intronic
1057582754 9:96302182-96302204 ACTCCTGGAAGAAGATCTGGAGG - Intergenic
1059672712 9:116506682-116506704 TCTCCTGCCTGACTTTTTGGGGG - Intronic
1059948392 9:119436620-119436642 TCTCCTGGATGACAGTCATGAGG - Intergenic
1061475566 9:130863554-130863576 TTTCCTGGATGCCTTTCTAGCGG - Intronic
1185456792 X:314802-314824 TCACCTGTAGGGCGTTCTGGGGG - Intronic
1186780015 X:12903080-12903102 TCTGCTGGATGACATTTTGGTGG - Intergenic
1190482180 X:50888635-50888657 TCTTCTGGATAACTTTCTGTAGG + Intergenic
1190908734 X:54752933-54752955 TTTACTAGTTGACGTTCTGGAGG + Intronic
1191002308 X:55673750-55673772 CCTCCTGTATGAGGTTCTGTTGG + Intergenic
1191216175 X:57934196-57934218 TCTCCAAGAAGAGGTTCTGGAGG - Intergenic
1191945582 X:66531223-66531245 TCTCCTGGCTGACCTCTTGGTGG + Intergenic
1196836526 X:119819009-119819031 TCTCCTTATTGACTTTCTGGAGG + Intergenic