ID: 1034669532

View in Genome Browser
Species Human (GRCh38)
Location 7:152847602-152847624
Sequence ATGAAGTAGCTGAAGGAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 265}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034669530_1034669532 -10 Left 1034669530 7:152847589-152847611 CCAATATACACGGATGAAGTAGC 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1034669532 7:152847602-152847624 ATGAAGTAGCTGAAGGAATCTGG 0: 1
1: 0
2: 3
3: 31
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034669532 Original CRISPR ATGAAGTAGCTGAAGGAATC TGG Intronic
901305163 1:8227477-8227499 ATGAAGTAGGTGGAGGAAGATGG + Intergenic
901667206 1:10833024-10833046 AGGAAGTCCCAGAAGGAATCTGG + Intergenic
903053179 1:20616674-20616696 ATGAAAAAGCTGAAGGAGGCAGG + Intronic
904427155 1:30436100-30436122 TTGAAGTAGCTAAAGGACTATGG - Intergenic
904899088 1:33842156-33842178 TTGAAGGAGATGAAGGAGTCAGG - Intronic
904951024 1:34238966-34238988 GTGAAGGAGATGAAGGATTCAGG - Intergenic
905179845 1:36158653-36158675 ATGATTTAACTCAAGGAATCTGG + Intronic
905491121 1:38344557-38344579 CTGAAGTAGGGGACGGAATCGGG + Intergenic
905823909 1:41015201-41015223 AGGAAGCAGCTGGAGGAGTCTGG + Intergenic
907151694 1:52294748-52294770 ATGAATCAGCTAAATGAATCAGG + Intronic
907481800 1:54750103-54750125 ATGAAGTTGAAGAAGGAATTGGG + Intergenic
908767252 1:67565318-67565340 GAGAATTGGCTGAAGGAATCAGG + Intergenic
910714944 1:90220604-90220626 CTCAAGTAGCTAAAGCAATCTGG - Intergenic
912037408 1:105335725-105335747 ATAAAGTAGCTGGGGGAATTGGG + Intergenic
912466756 1:109879952-109879974 GTGAAGTAGGTAAAGGAATGAGG + Intergenic
912587000 1:110776236-110776258 ATGAAGGAAAGGAAGGAATCCGG - Intergenic
913092032 1:115482797-115482819 CTGAGATAGGTGAAGGAATCAGG - Intergenic
914780037 1:150777142-150777164 ATGAAGGATTTGCAGGAATCTGG + Intergenic
915264950 1:154710082-154710104 TTGAAGTAATTGAAGCAATCGGG + Intronic
917910196 1:179636225-179636247 TTGAAGTATCTGAAGACATCTGG + Intronic
918604530 1:186406173-186406195 ATGAGTCAGCTGAAGAAATCAGG + Exonic
921802556 1:219418046-219418068 ACGCAGTAGCTGATGAAATCAGG - Intergenic
922086101 1:222348270-222348292 ATGAAGGACATGAAGGAAACTGG + Intergenic
1066473039 10:35717723-35717745 ATGAAAAAGCTCCAGGAATCAGG + Intergenic
1067075957 10:43182441-43182463 ATGAAATTACTGAAGGAATTTGG - Intronic
1067082365 10:43218901-43218923 TTGAATTGACTGAAGGAATCTGG + Intronic
1067099222 10:43322671-43322693 AGGTAGACGCTGAAGGAATCCGG + Intergenic
1067397840 10:45939730-45939752 ATTCAGTAACTGAAGGAATGTGG - Intergenic
1067866160 10:49908824-49908846 ATTCAGTAACTGAAGGAATGTGG - Intronic
1068160583 10:53257692-53257714 ATAAAGAAGCTGCAGGTATCTGG + Intergenic
1070363957 10:75717645-75717667 ATGAGGTAGCTGAAGTCATCTGG - Intronic
1070625631 10:78049098-78049120 ATGAATGAGCTGAAGGACTTGGG - Intronic
1070855553 10:79605767-79605789 ATGAAATAGCTGAGGGAAACGGG - Intergenic
1071239005 10:83683207-83683229 ATGAGGTTGCTGAAAGTATCAGG - Intergenic
1076814582 10:132908471-132908493 ATCAAGTACCTGAAGAAATTTGG - Exonic
1077442145 11:2573847-2573869 AGGATGCAGCTGCAGGAATCAGG + Intronic
1077963445 11:7100194-7100216 GTGAGGTAGTTGAAGGATTCAGG - Intergenic
1079074516 11:17375716-17375738 ATGAAATAGCGAAAGGAAACAGG + Exonic
1080481720 11:32658104-32658126 ATGAAGCAGATGCTGGAATCTGG - Intronic
1081388960 11:42506105-42506127 ATGAAGTAGCTGCAGGCTTATGG - Intergenic
1083104466 11:60344781-60344803 ATGAAGTAGCTGAAGGAAATAGG - Intronic
1085587957 11:77729112-77729134 AAGAAGCACCTGATGGAATCTGG + Intronic
1086002389 11:81998720-81998742 ATGAAATAGCTGAGGGAAACAGG - Intergenic
1086084446 11:82940341-82940363 ATGATGTACCTAAAGGAATTAGG + Intronic
1086458502 11:86982910-86982932 ATGAAGCAGCTAAAGGGATTAGG + Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088497946 11:110450964-110450986 ATGATGTATATGAAGGAATGAGG - Intronic
1090271631 11:125389965-125389987 AGGAGGCACCTGAAGGAATCAGG + Intronic
1090594340 11:128305295-128305317 ATGAAGTAGCTCAAAGTCTCAGG - Intergenic
1091418985 12:318217-318239 ATGAAGAAGCTGATAGACTCTGG - Exonic
1092005118 12:5062711-5062733 ATGAGCTTGTTGAAGGAATCAGG - Intergenic
1092912804 12:13163085-13163107 ATGAAACAGGTGAAGGAATTAGG + Intergenic
1095721947 12:45410308-45410330 ATGAAGTCACTCAAGGAACCAGG - Intronic
1097923664 12:65104939-65104961 ATGAAGTAGCTGAAGAAATTGGG + Intronic
1098831548 12:75370979-75371001 ATGCAATAGCTGAGGGAAGCTGG - Intronic
1098879106 12:75898366-75898388 AAGAAGAAGCTGTAGGAATCTGG + Intergenic
1099869120 12:88324004-88324026 CTGAATTAGCTGTAGGAATTAGG - Intergenic
1102397798 12:112602249-112602271 ATGAAGGAGTGGAAGGAATGGGG - Intronic
1102803772 12:115761261-115761283 AGGATTTAGCTGAAGGAAGCTGG + Intergenic
1103858755 12:123994580-123994602 TTGAAGTAGATGAAGAAATCCGG + Intronic
1105987911 13:25587644-25587666 ATGAAGTTGCTGAAAGTCTCTGG + Intronic
1106523401 13:30518503-30518525 ATTTAGTTGCTGAAGGACTCTGG + Intronic
1107122631 13:36812107-36812129 ATGAAGGATCTGAAGAAAGCTGG + Intergenic
1107419404 13:40232807-40232829 ATGAAAAAGATGGAGGAATCCGG - Intergenic
1109959891 13:69616242-69616264 AAGTAGTAGCTGAGGTAATCTGG + Intergenic
1110072925 13:71200796-71200818 AAGAAGCAGCTGGTGGAATCAGG + Intergenic
1110599364 13:77354446-77354468 ATGAATTAACTGAATGAAGCAGG + Intergenic
1111314753 13:86539903-86539925 ATCCAGTAGCTAAAGGAATAGGG + Intergenic
1111908844 13:94287537-94287559 ATGAAGGAGAAGAAAGAATCTGG + Intronic
1112037331 13:95508772-95508794 ATGAAGTAGTTGGAGGAGCCGGG + Intronic
1112350828 13:98631783-98631805 AGGAGGTGGCTGCAGGAATCTGG - Intergenic
1113580520 13:111425582-111425604 ATGAAGGAGCTCCAGGGATCAGG - Intergenic
1114803414 14:25805523-25805545 ATGAAGTAGCAGTAGGGAGCAGG - Intergenic
1115257008 14:31413825-31413847 ATGAAGTAGTTGAAAGAATGTGG - Intronic
1116141304 14:40997959-40997981 ATGAAGTAGATGAACAAATTTGG - Intergenic
1119858354 14:77918015-77918037 ATTAAACAGGTGAAGGAATCAGG - Intronic
1120267795 14:82273803-82273825 ATGAAGTAACTTAAGGAAGCTGG - Intergenic
1120880482 14:89412109-89412131 ATGAGGCAGCTGAAGGAGTAGGG + Exonic
1121051360 14:90820882-90820904 ATGAATGAGCTGAAGGAAGGTGG + Intergenic
1122187486 14:100012080-100012102 ATGAAGTTGCTGAATGTACCTGG - Intronic
1123963392 15:25431266-25431288 ATGAAGCAGCTTAAGTAATTAGG + Intronic
1124994469 15:34709502-34709524 ATAAAGTAGCTCATGGAGTCCGG - Intergenic
1125056317 15:35361677-35361699 ATCAAGCAGAAGAAGGAATCAGG - Intronic
1125369706 15:38959987-38960009 GTGAATTAGTTAAAGGAATCAGG - Intergenic
1125382681 15:39103824-39103846 ATAAATTAGTTTAAGGAATCAGG + Intergenic
1126324404 15:47460995-47461017 AGGAAGTGGCTGGAGGAAGCAGG - Intronic
1127907655 15:63388307-63388329 AAGTAGGAGCTGAAGGACTCAGG - Intergenic
1129932775 15:79426155-79426177 ATGCAGGAACTGAAGGAAACTGG + Intronic
1130160922 15:81399134-81399156 ACTAAGCAGCTGAAGGAATTGGG - Intergenic
1132231284 15:100186130-100186152 ATGAAGTATGTGAAGGAAGTAGG + Intronic
1132238628 15:100240320-100240342 CTGACGTTGCTGAAGGCATCTGG - Intronic
1134603461 16:15551477-15551499 CTGATGTAGCTGAGGGCATCAGG + Intronic
1135383898 16:22019143-22019165 ATGAAGTCACTGAAGGTTTCTGG - Intronic
1137747188 16:50831143-50831165 ATGGAGAAGCTGCAGGAATCTGG - Intergenic
1138125985 16:54438926-54438948 ATGAAGTAATTGAATGAATGAGG + Intergenic
1138313310 16:56046878-56046900 AAGAAGTACCTGTAGGAGTCAGG + Intergenic
1138841858 16:60519070-60519092 ATGATGTATCTCAAGGAATTAGG + Intergenic
1139795101 16:69476422-69476444 TTGAGGTAACTGAAGGAACCTGG + Intergenic
1141745713 16:85924751-85924773 AAGAAGCAGCTGTGGGAATCAGG + Intergenic
1144301727 17:13927639-13927661 ATGAAATAGCTGAGGGAAATGGG + Intergenic
1144365311 17:14538328-14538350 TTGAAGTGTTTGAAGGAATCAGG + Intergenic
1147980150 17:44269112-44269134 ATGGACTGGCTGAAGGAACCTGG + Intergenic
1151008570 17:70466167-70466189 AAGACTTAGCTGAAGCAATCAGG + Intergenic
1151030955 17:70738602-70738624 ATGAAGAAGATGAGGGAATGGGG - Intergenic
1151313226 17:73307065-73307087 AAGATGGAGCTGAAGGCATCTGG - Intronic
1154510752 18:15099074-15099096 AGGAAGTAACTGATGGAATCAGG + Intergenic
1155312425 18:24536900-24536922 ATAAAATAGTTGAAGGAATCAGG - Intergenic
1155839356 18:30627836-30627858 ATGAAAAAGCTGAAGGAAATAGG - Intergenic
1157040986 18:44038506-44038528 GTGGAGTAGCTAAAGGAAACTGG + Intergenic
1158032799 18:52987202-52987224 AAGAAGTAGCAAAAGCAATCAGG + Intronic
1158507378 18:58058587-58058609 AAGAATTAACTGAAGGAATTTGG + Intronic
1158683724 18:59593863-59593885 ATCAAGTAGCTGTAGGTCTCAGG + Intronic
1158971753 18:62674631-62674653 ATGAAGGAGCTGAAGGAGATGGG - Intergenic
1159263811 18:66052401-66052423 ATGAACTAACTAAAGGAAACCGG - Intergenic
1159471051 18:68856631-68856653 CTGTATTAGCTGAAGGACTCAGG + Intronic
1161469248 19:4448092-4448114 ATGAAGGTGTTGAAGGAATCAGG - Intronic
1164035253 19:21448721-21448743 ATGAAATTGATGAAGGAGTCTGG - Intronic
1165906091 19:39195948-39195970 AGGAAGTGGCTGTGGGAATCTGG + Intergenic
1166487602 19:43226863-43226885 ATGAAGTAGCCAAAGGAAATAGG - Intronic
925722394 2:6841756-6841778 ATGAAATAGCTGAAGGAAATAGG - Intronic
928336930 2:30406246-30406268 ATGAAGAAGTGGAAGGAATTTGG - Intergenic
928616363 2:33043662-33043684 AGGAAGTAGAAGAAGGAATTTGG + Intronic
932237673 2:70134103-70134125 ATGAAATGACTGAAGGAATCTGG + Intergenic
932482908 2:72059198-72059220 AAGAACTTGCTGTAGGAATCTGG + Intergenic
932553170 2:72793571-72793593 CTGAACTAGCTGGAGGAGTCAGG + Intronic
933178803 2:79206894-79206916 ATCAAGTAGCTGAAAGATGCAGG - Intronic
938088439 2:128417034-128417056 AGGAAGCAGCTGAAGGAACCTGG + Intergenic
938225432 2:129611804-129611826 ATGAAGAAGCAGAGGAAATCAGG - Intergenic
938505972 2:131883533-131883555 AGGAAGTAACTGATGGAATCAGG + Intergenic
938945620 2:136209395-136209417 ATGAGGAAGCTGAAGGATTAGGG + Intergenic
940266124 2:151840874-151840896 ATCAAGTAGCTGCTGGAATGTGG - Intronic
940681227 2:156787549-156787571 ATGTATTAACTGAAGTAATCGGG + Intergenic
940759251 2:157719703-157719725 ATGAAGTATGTGAACGAATGAGG + Intergenic
942426003 2:175861631-175861653 ATGAAGAAGAGCAAGGAATCAGG - Intergenic
942516582 2:176760279-176760301 ATGAACTAGATGAAGGCATTGGG - Intergenic
943575501 2:189626688-189626710 ATAAAGAAGATGAAGCAATCAGG + Intergenic
945139122 2:206665119-206665141 TTGAAGTATCTGAAGAAATCAGG - Intronic
945517846 2:210784869-210784891 ATGAAGTCGAAGCAGGAATCTGG - Intergenic
945564914 2:211385555-211385577 ATTAAGAAGTTTAAGGAATCTGG - Intronic
946505396 2:220295105-220295127 GTGGAGTAACTGCAGGAATCAGG - Intergenic
947079428 2:226379654-226379676 ATGATGTAGCTCAAGGAAAGAGG - Intergenic
1169794721 20:9449374-9449396 AGGAAGTAGCTGAGGGAAGTTGG + Intronic
1170421706 20:16199904-16199926 ATGTGGTAGCTGACTGAATCAGG - Intergenic
1171221384 20:23401072-23401094 AAGAGGGAGCTGAAGGAAGCAGG + Intronic
1172322613 20:34008272-34008294 ATGGAGATGCTGAAGGAATCTGG + Intronic
1172679329 20:36700130-36700152 AAAAAGTAGATGAAGGAATAGGG + Intronic
1172811879 20:37654030-37654052 ATGATGTAGTGGAAGGAACCAGG - Intergenic
1175539371 20:59738691-59738713 AGGAAGGATCTGGAGGAATCAGG - Intronic
1176383043 21:6122899-6122921 CCGAAGTAGCTGAAGGCACCTGG - Exonic
1176670160 21:9726502-9726524 ATGAACTAGCTGTAGAAATATGG + Intergenic
1176787100 21:13270205-13270227 AGGAGGTAACTGATGGAATCAGG - Intergenic
1176932436 21:14829538-14829560 ATGAACTAGGTGAGGGACTCTGG + Intergenic
1177888466 21:26775806-26775828 ATGAAGGAGCTGAAGCCATCTGG - Intergenic
1177891387 21:26808159-26808181 TTGAAGTCCCAGAAGGAATCTGG + Intergenic
1177963362 21:27696877-27696899 ATGAAGAAGATGAAGGAGTTAGG + Intergenic
1177986268 21:27978847-27978869 AGGGAGTAACTGATGGAATCAGG - Intergenic
1179507888 21:41853875-41853897 GTGGAGTAGATGAAGAAATCAGG - Intronic
1179740426 21:43415340-43415362 CCGAAGTAGCTGAAGGCACCTGG + Exonic
1180261165 21:46670009-46670031 ATGAAGTAACTAAATGAATCTGG + Intergenic
949207101 3:1453393-1453415 GTGAAGTAGATGAAGAAATCTGG + Intergenic
950244486 3:11403631-11403653 ATTAAGTAGGTGAAGCAGTCTGG + Intronic
951849626 3:27124691-27124713 AAGAATTAGCTGAAGGAAAACGG + Intronic
952841644 3:37651760-37651782 GTGAACCAGCTGGAGGAATCTGG + Intronic
954975073 3:54685810-54685832 ATGAGGTGGAGGAAGGAATCAGG - Intronic
955269981 3:57487708-57487730 ATAAACTAGGTGAAGGAAACTGG + Intronic
956913358 3:73844635-73844657 AGAAAGAAGCTGAAGGAATAAGG + Intergenic
957495763 3:80989761-80989783 ATGAAGTTGCTGAAGCAATATGG - Intergenic
957515045 3:81239455-81239477 AGGAAGTAGCAGAAGAAAACAGG + Intergenic
957911174 3:86621527-86621549 ATGAAGCAGCAGAAGGAAATAGG + Intergenic
958434029 3:94075931-94075953 ATGAAGACCCTGAAGGAATATGG - Intronic
958481793 3:94653079-94653101 TTGGAATACCTGAAGGAATCAGG - Intergenic
958953005 3:100436564-100436586 AGTAATTAGCTGAAGGCATCTGG - Intronic
960260876 3:115567063-115567085 ATGAAGGAGATGAAGGAGACTGG + Intergenic
961184572 3:124903351-124903373 ATTAGGTAGTTGAAGGAAACGGG + Intergenic
963577760 3:147083545-147083567 ATTAACTAGCAGAAGTAATCTGG + Intergenic
965489079 3:169314847-169314869 ATGAGGAAGCTGGAGGATTCTGG + Intronic
966883005 3:184360498-184360520 AGAAAGTAGCTGGATGAATCAGG - Intronic
969651813 4:8472458-8472480 ATGAAGTAGCCGTGGGGATCAGG + Intronic
970025767 4:11622500-11622522 ATGATGGAGCTGGAGGAATGAGG - Intergenic
970254826 4:14156398-14156420 AGGAAGCAGCTAAAGGAATTAGG - Intergenic
971290522 4:25334765-25334787 TTGAAGGTGTTGAAGGAATCAGG + Intronic
972184113 4:36507397-36507419 ATAAACTGGCCGAAGGAATCAGG - Intergenic
972267483 4:37476416-37476438 ATGAAGATGCTGAAGGGATATGG - Intronic
972798413 4:42446341-42446363 GTTAAGTAGCAGAAGGAATGAGG - Intronic
973708483 4:53602637-53602659 ATGAAGTAGCTGAGGAGATGGGG + Intronic
975038356 4:69712314-69712336 ATGAAGGAACTGATGGAATCAGG + Intergenic
975387729 4:73777867-73777889 ACGGAGTAGCTGATGGACTCTGG + Intergenic
975794490 4:77992815-77992837 ATGAAGTAGCTTCAGCTATCAGG - Intergenic
976675342 4:87696558-87696580 ATGAAGTAGCCAAAGGTCTCAGG + Intergenic
977522840 4:98107415-98107437 GTGAAGTAACTGAAGCAGTCAGG + Intronic
978994658 4:115135463-115135485 ATGATGTAGCTGGAGCAATCAGG + Intergenic
980732451 4:136840308-136840330 ATCAAGGAACTGAATGAATCAGG + Intergenic
982263196 4:153514061-153514083 ATGCAGTATCTGAGGGAAACTGG - Intronic
982594863 4:157368346-157368368 CTGAATTAGCTGAATGAATTTGG + Intergenic
983164029 4:164452363-164452385 ATGGAGTTGCTGATGGAAGCAGG - Intergenic
983354593 4:166639274-166639296 ATTAAGAAACTGAAGGAAACTGG - Intergenic
984142372 4:176019413-176019435 AGGAAGTAGATGAAGAGATCTGG - Intergenic
984982325 4:185294446-185294468 ATGAAGATACTGAAGGAGTCAGG + Intronic
985404620 4:189625036-189625058 ATGAACTAGCTGTAGAAATATGG - Intergenic
985747682 5:1656393-1656415 ATGGAGGAGCTGAGGGCATCGGG - Intergenic
986491793 5:8299887-8299909 ATGAGGTAGCTGAAGGAATTAGG - Intergenic
987267459 5:16271921-16271943 ATGAATTACCTGAAACAATCAGG - Intergenic
988003354 5:25378046-25378068 ATAAAGCAGCTGAAAGATTCAGG - Intergenic
988246748 5:28694202-28694224 AAGAAGTAGCTGAAAGAATATGG + Intergenic
989029771 5:37106814-37106836 ATGAAGTAGTTGAAGGATACTGG + Exonic
990245721 5:53861711-53861733 ATGTAGTAAGTGAAGGATTCAGG + Intergenic
990372261 5:55132197-55132219 GAGAAGGAGCTGAAGGAATAGGG + Intronic
990964394 5:61429469-61429491 ATGAAGGAAATGAAGGAATCTGG + Intronic
991422858 5:66459061-66459083 ATAAAGTATCTGAAGCAATTGGG + Intergenic
992350163 5:75920664-75920686 ATGAAGGAGCTGCAGGAGTGAGG - Intergenic
992398411 5:76388685-76388707 ATGAAATAGCTGAATGAAGAAGG - Intergenic
994774974 5:104029194-104029216 ATGAAGTAACTGAGGGAAATTGG + Intergenic
996760756 5:126983860-126983882 ATGAAAAAGATGAAGGAAGCTGG - Intronic
996800028 5:127392908-127392930 ATGAAATATCTGCATGAATCTGG + Intronic
997969995 5:138393203-138393225 GTGAAGAAGCTGAAGCAATCTGG + Exonic
998922377 5:147083867-147083889 ATGAAGGAACTGGAGGATTCAGG + Intronic
999197577 5:149793018-149793040 ATGAAGCAGCTGAGGGTATGTGG - Intronic
1000486967 5:161858713-161858735 ATGCTATAGCTGAAGGAATGAGG + Intronic
1001447639 5:171798170-171798192 ATGAAGAAGTTGAAAGAACCAGG + Intergenic
1001951189 5:175817755-175817777 ATGAAGGAGGTGAGGGGATCAGG + Intronic
1004117168 6:12780889-12780911 ATGAAGTGGGGGAAGGAATGGGG + Intronic
1004927904 6:20433123-20433145 ATGAAGAACTTGAAGGAAGCTGG + Intronic
1005170773 6:22981832-22981854 CTGGAGTATCTGAAGGAGTCTGG + Intergenic
1005688079 6:28274350-28274372 ATAAAGTAGCTGAAAGAAAGGGG + Intronic
1005690166 6:28297187-28297209 AAGGAGTCACTGAAGGAATCAGG - Intronic
1006289043 6:33120239-33120261 ATGAAGTAGCCAAAGGAAATAGG - Intergenic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1008573812 6:52839699-52839721 AGGCAGTCGCTGAAGGACTCTGG + Intronic
1008705108 6:54148299-54148321 ATGAGGAAGCTGTAGAAATCAGG - Intronic
1008875142 6:56317816-56317838 ATCAAGTAGGTGAAGGAAGGTGG - Intronic
1010830579 6:80523587-80523609 AGGAAGTAGCTAAAGAATTCCGG - Intergenic
1011017076 6:82768779-82768801 AGGAAGCAGATAAAGGAATCAGG + Intergenic
1016562971 6:145417894-145417916 CTGAAGGAGCTGAAGGAGTGTGG - Intergenic
1016629520 6:146212092-146212114 ATGTATTAACTGAGGGAATCAGG + Intronic
1016909301 6:149181484-149181506 ATGATGTAGTTAAAGAAATCAGG - Intergenic
1017642876 6:156511318-156511340 AGTAAATAGCTGAATGAATCGGG - Intergenic
1019043192 6:169122981-169123003 ATGAAGTGGCTGAGGGAAATAGG + Intergenic
1021891006 7:25186331-25186353 AGGGAGTAGCTGGAGGAATTTGG - Intergenic
1022130400 7:27399736-27399758 ATGCAGGAGCTGAAGGTATTAGG - Intergenic
1022791336 7:33692270-33692292 ATGAATTAGCTGTAGGAACTGGG + Intergenic
1025819913 7:64952974-64952996 ATGAAGTAGCCAAAGGAAACAGG - Intergenic
1025852536 7:65256566-65256588 ATGAAGCAGAAGAAGGAATCAGG + Intergenic
1027823022 7:83072656-83072678 ATGCTGTAGCTGAACGAAACTGG - Intronic
1028215433 7:88126402-88126424 ATCAAGAAGTTGAAGGAACCAGG + Intronic
1028231757 7:88314028-88314050 ATAAAGTAGCTGGAGGCATCTGG - Intergenic
1028354017 7:89884811-89884833 ATTATGTATCTGAAGGAACCTGG + Intergenic
1028409970 7:90519835-90519857 ATGAAGGAGGTGAAGGAAGAAGG - Intronic
1028579984 7:92398637-92398659 CTGTAGTTGCTGGAGGAATCAGG - Exonic
1029034201 7:97501724-97501746 ATGAAGTAAATAAAGAAATCAGG - Intergenic
1030402222 7:109066098-109066120 ATGATGTACCTCAAGGAACCAGG - Intergenic
1030489249 7:110211428-110211450 CTGAAGGAGCTGAAAGAAACTGG - Intergenic
1031235712 7:119173711-119173733 ATGAAGGAGCTGAAGAAAATTGG + Intergenic
1031517334 7:122717574-122717596 ATGAAGTAGCTTCAAGATTCAGG + Intronic
1032204357 7:129848889-129848911 ATTAAGTACCTAAAGAAATCTGG - Intronic
1032260075 7:130328549-130328571 GTGAAGTAGCTGACAGAATGAGG + Intergenic
1033130454 7:138741264-138741286 AGGTAGCAGCTGAGGGAATCGGG + Intronic
1034505940 7:151491103-151491125 ATGAAGACACTGAAGGTATCAGG + Intronic
1034669532 7:152847602-152847624 ATGAAGTAGCTGAAGGAATCTGG + Intronic
1036125709 8:6060040-6060062 TTGAAGCAGCTGTAAGAATCAGG + Intergenic
1036969851 8:13343225-13343247 ATGAACTAACTGGAGGAAGCCGG - Intronic
1040095289 8:43436737-43436759 ATGAAGTAGATGAAGAAAATAGG + Intergenic
1040829767 8:51663677-51663699 ATGTAGCAGATGAAGAAATCTGG - Intronic
1043380293 8:79695290-79695312 ATGAAGAGGCAGAAGGACTCAGG + Intergenic
1043583022 8:81735400-81735422 ATGAAGTATATGAAGTTATCTGG - Intronic
1043737058 8:83761643-83761665 ATGCAGAAGCTTAAGGAATATGG + Intergenic
1045739760 8:105343405-105343427 AGGCAGTAGCTGAAGGAATTGGG + Intronic
1048186685 8:132248580-132248602 ATGAAATAGCTTAACAAATCTGG - Intronic
1048794718 8:138139063-138139085 ATGCAGAAACTGAAGAAATCCGG - Exonic
1050763796 9:9107609-9107631 AGGAAGTAGGTGAGAGAATCAGG + Intronic
1051930140 9:22375242-22375264 GTGGAATAGCTGAAGGAAACTGG - Intergenic
1054773825 9:69107920-69107942 ATGAAGTAACTGAAGATTTCTGG + Intergenic
1054919433 9:70526954-70526976 TAGAAGGACCTGAAGGAATCGGG - Intergenic
1055481065 9:76709679-76709701 ATGAAGCAGCTCCAGAAATCTGG - Exonic
1055565144 9:77560687-77560709 TTGAAGTAGCTGTTGGAACCAGG - Intronic
1055840467 9:80497120-80497142 ATGGAGCAGCTGCAGGAATGGGG - Intergenic
1056070186 9:82978335-82978357 ATCAAGTAGTGGAAGGAATGAGG - Intergenic
1056127662 9:83552620-83552642 ATGAACTTGCTTTAGGAATCTGG + Intergenic
1057614050 9:96572246-96572268 ATTAATTTGCTGGAGGAATCGGG - Intronic
1059818228 9:117942240-117942262 AAGAAGTAGATGCAAGAATCAGG + Intergenic
1059875267 9:118627759-118627781 TTGAAGTTTGTGAAGGAATCTGG - Intergenic
1059953802 9:119495307-119495329 ATGATGTAGAGGAAGGAAGCAGG + Intergenic
1061321487 9:129833456-129833478 ATGAAGAAACTGAAGGAAAGGGG - Exonic
1062448021 9:136603917-136603939 AGGAAGTAGCTGGAGAAGTCGGG + Intergenic
1185935106 X:4247909-4247931 GTGAAGTCCCTCAAGGAATCTGG - Intergenic
1186663906 X:11699233-11699255 ATGATGTTGCTGAAGGAGCCAGG - Intergenic
1191638345 X:63402417-63402439 ATGTAGTGGCTGAATGAATTTGG - Intergenic
1192637691 X:72835169-72835191 ATGTGGAAGCTGAAGGAAACTGG + Intronic
1192644023 X:72885646-72885668 ATGTGGAAGCTGAAGGAAACTGG - Intronic
1193658805 X:84231639-84231661 ATGAAGTAGCTAGAGGAAAGTGG + Intergenic
1194488364 X:94514982-94515004 AAGAAGTAGCTGGAGTAAGCTGG - Intergenic
1195147326 X:102030554-102030576 TTGAAGTATCTGAAGGAGACAGG + Intergenic
1195280548 X:103328774-103328796 ATAAAATGGCTGAAGGATTCGGG - Intergenic
1195539278 X:106044023-106044045 ATTGTGTAGCTGAAAGAATCAGG - Intergenic
1196155136 X:112420134-112420156 ATGAATTATCTGAAGTTATCTGG - Intergenic
1196297553 X:114016131-114016153 GGGAAGGAGCTGAAAGAATCTGG + Intergenic
1197029953 X:121801752-121801774 TTGAAGTACCTGAAGGAGACGGG - Intergenic
1197398077 X:125952401-125952423 TTGAAGTTTCTGAAGGAAGCTGG - Intergenic
1198700393 X:139391358-139391380 ATGAAGTAGCAGGAGGAGTTTGG - Intergenic
1199183465 X:144886882-144886904 ACCAAATAGCTGAAGAAATCAGG - Intergenic
1199411602 X:147530051-147530073 ATGAAATATATGAAGGAAACGGG - Intergenic