ID: 1034669627

View in Genome Browser
Species Human (GRCh38)
Location 7:152848250-152848272
Sequence GCCCCTCTCCTACACTGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034669618_1034669627 15 Left 1034669618 7:152848212-152848234 CCAAGTCTGGGGTGACAGTCAGG 0: 1
1: 0
2: 0
3: 18
4: 181
Right 1034669627 7:152848250-152848272 GCCCCTCTCCTACACTGCGGTGG 0: 1
1: 1
2: 0
3: 8
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034669627 Original CRISPR GCCCCTCTCCTACACTGCGG TGG Intronic
900109691 1:1000286-1000308 GCCCCCCTCCGACACCGCTGGGG + Intergenic
900820950 1:4888174-4888196 GCACCTCTCCATCACTGTGGTGG + Intergenic
902402640 1:16166501-16166523 GCCCCCCACCTACACTGCGCTGG - Intergenic
903872018 1:26442720-26442742 TCCCCTCTCAGACTCTGCGGTGG + Exonic
905878769 1:41450006-41450028 TCCCCTCTCCATCACTGGGGAGG - Intergenic
906028409 1:42696231-42696253 CTCCATCTCCTACACTGCGAAGG - Exonic
918511254 1:185316661-185316683 GCCCCTTTGCTACACTGGCGCGG - Intronic
919084950 1:192910578-192910600 TCCCTTCTCCAACACTGCTGGGG - Intergenic
920746282 1:208631990-208632012 GTTCTTCTCCTCCACTGCGGTGG + Intergenic
922366835 1:224873527-224873549 CCTCCTCTCCTTCACTGAGGAGG + Intergenic
924433948 1:244022112-244022134 GCCCCTCTCCTTGCCTGCTGTGG + Intergenic
1063670501 10:8095998-8096020 GCCCCTCTGCTCCTCTGCGAGGG + Intergenic
1065743161 10:28815400-28815422 GGCCCTCTTCCACACTGTGGAGG - Intergenic
1065916060 10:30355847-30355869 GCCACTTTCCTCCACTGCTGGGG - Intronic
1067090536 10:43264044-43264066 GCCCCTCTCCCACTCTGAGCAGG + Intronic
1068172054 10:53406515-53406537 GTCCATCTCCTGCACTGCTGAGG - Intergenic
1072170424 10:92854490-92854512 GGCACTCTCATACACTGCTGTGG + Intronic
1072636391 10:97181220-97181242 GCACCTCCCCTACACAGCGCAGG + Intronic
1074159944 10:110829153-110829175 GCCCCTCTCCTATACTGCGGGGG + Intronic
1075723049 10:124598402-124598424 GCCACACTCCTGCCCTGCGGTGG - Intronic
1080413071 11:32044567-32044589 GCCCCCCTCCACCACTGCAGGGG - Intronic
1080617162 11:33954622-33954644 TCCTCTCTCCTACACTGCAGCGG - Intergenic
1083518531 11:63283771-63283793 ACCCTTTTCCTACACTGCGGAGG + Intronic
1083623449 11:64060013-64060035 GCCCCCCTCCCACACGGCAGGGG + Intronic
1085485431 11:76859774-76859796 TCCCCTCTCCTAGAATGCGCTGG - Intergenic
1087058725 11:93958059-93958081 GCCCCTCCCCTACATGGCAGAGG - Intergenic
1087760895 11:102103519-102103541 GCCCCTTGCCTACTCTGGGGTGG + Intergenic
1088647042 11:111925892-111925914 GCCCCTCACCTCCAATGCAGGGG - Intronic
1094398224 12:30031832-30031854 GCAACTCTCCTACATTGCTGTGG + Intergenic
1097925933 12:65126261-65126283 ACCCCTGTACTACACTGCTGTGG + Intergenic
1104661853 12:130616998-130617020 GCCCCCCTCCTCCTCTGCAGAGG + Intronic
1106720247 13:32428359-32428381 GCCCCTCCCCTCCACTGCTCAGG - Intergenic
1111942076 13:94620466-94620488 GGCCATCACCTACACTGCAGGGG - Intronic
1112339078 13:98537720-98537742 GCCCCTGCACTACACTGAGGGGG - Intronic
1113713821 13:112488999-112489021 GCCCCTGTGCTCCACTGTGGTGG - Intronic
1113713837 13:112489042-112489064 GCCCCTGTGCTCCACTGTGGTGG - Intronic
1113713853 13:112489084-112489106 GCCCCTGTGCTCCACTGTGGTGG - Intronic
1113713869 13:112489127-112489149 GCCCCTGTGCTCCACTGTGGTGG - Intronic
1114063384 14:19039022-19039044 GCCCCGCTCCTGCACAGAGGCGG + Intergenic
1114098872 14:19360974-19360996 GCCCCGCTCCTGCACAGAGGCGG - Intergenic
1118463851 14:66013483-66013505 CTCCATCTCCTACACTGCGAAGG + Intergenic
1121005922 14:90490693-90490715 GCCCCTCGCCTTCACTGGAGAGG + Intergenic
1128613282 15:69090469-69090491 GGCTCTCTCCCACACTGGGGAGG + Intergenic
1134199465 16:12185826-12185848 GTCCCTTTCCTACAATGCAGAGG - Intronic
1135589480 16:23694920-23694942 GCCCCTCTCCCACAGTGCACCGG - Exonic
1135636258 16:24078227-24078249 CCCCCTCTCCCACGCTGCAGCGG - Intronic
1136029668 16:27493480-27493502 GCCCATCTACCACACTGCAGAGG + Intronic
1136272944 16:29159188-29159210 CACCCTCTCCTTCACTGGGGTGG + Intergenic
1146912369 17:36657060-36657082 GCCCCTTTCCCAGTCTGCGGAGG + Intergenic
1147842064 17:43378917-43378939 CCCCCTCTCCCCCACTGGGGGGG + Intergenic
1148350845 17:46940958-46940980 GACCCTTCCCTACACTGAGGCGG - Intronic
1151460246 17:74250007-74250029 GCCCCTCTTCTCCACTGCAGAGG + Exonic
1151674626 17:75591107-75591129 GCACCTCTGCTACACCTCGGAGG + Intergenic
1152941449 17:83174805-83174827 GCCTCTCTCCTACCTGGCGGGGG + Intergenic
1153805248 18:8705145-8705167 GCCCCTCCCCTGCACGGCGCCGG + Intergenic
1158241089 18:55379380-55379402 GCTCCTCCCCTACACTTCAGAGG - Intronic
1160263195 18:77314998-77315020 GGCCCACTCCCACACTGTGGAGG - Intergenic
1161524949 19:4748404-4748426 GCCCCTCCCCAACACAGCGCTGG + Intergenic
1162027103 19:7900634-7900656 GGCCCTCTCCTACAATGCCCTGG + Exonic
1163248417 19:16111535-16111557 TTCCCTCTCCTACAGTGGGGCGG + Intergenic
1163376832 19:16938309-16938331 CCCCCTTTCCCACACTGTGGGGG - Intronic
1165062446 19:33211419-33211441 GCTGCTCTCCTCCAATGCGGTGG - Exonic
1165532840 19:36418459-36418481 GCCCCTCTGCGATACTGCAGTGG + Intronic
1167699729 19:51035338-51035360 GCCCCTCCCCTGCACTGCATGGG - Intergenic
931865773 2:66409593-66409615 GCCTCTCTCCAACAATGGGGAGG - Intergenic
933729553 2:85446489-85446511 GCCCCTCTATTCCACTGCAGAGG - Intergenic
935671697 2:105561762-105561784 TCTCCTCTCTTACACTGTGGAGG + Intergenic
935826297 2:106953771-106953793 TCCCCTCTCCAACAGGGCGGAGG + Intergenic
935888859 2:107653735-107653757 GCCCTTCTCCAACAATGAGGTGG + Intergenic
936571677 2:113622402-113622424 TCCCCTCTCCCACACTGTGAAGG - Intergenic
937019657 2:118638823-118638845 GGCCCGCTCCCACACTGTGGAGG + Intergenic
938480730 2:131659191-131659213 GCCCCGCTCCTGCACAGAGGCGG + Intergenic
941662400 2:168208751-168208773 GCACCTCTCCATCACTGAGGCGG + Intronic
945404030 2:209423884-209423906 CCCCCTCCCGGACACTGCGGCGG + Intergenic
946029962 2:216695774-216695796 GCCCCTTTCTTACATTCCGGGGG - Intergenic
1172951099 20:38724070-38724092 GGCCCCCTCCCACCCTGCGGCGG + Intergenic
1174089789 20:48037831-48037853 GCCGCTCTCCTACTTTCCGGAGG - Intergenic
1174126507 20:48310736-48310758 GCCGCTCTCCTACTTTCCGGAGG + Intergenic
1174520905 20:51129804-51129826 AGCCCTCTCCTACACTGGTGAGG + Intergenic
1175313320 20:58026787-58026809 TCCCCTATCCTACACTGCTTAGG + Intergenic
1175484223 20:59333496-59333518 GCCCCTCACCCCCACTGTGGGGG - Intergenic
1176781626 21:13201730-13201752 ACCCCTGTCCTACAATGAGGAGG + Intergenic
1178383129 21:32128227-32128249 GCCCTCCTCCTACACAGCTGAGG - Intergenic
1178763175 21:35423451-35423473 GCCTCTCTCCTAGACTCTGGTGG - Intronic
1180481878 22:15761656-15761678 GCCCCGCTCCTGCACAGAGGCGG + Intergenic
1180857621 22:19058362-19058384 GCCCCTTTCCTGCTCTGCTGTGG - Intronic
1181060132 22:20278446-20278468 CCACCTCCCCTACCCTGCGGCGG - Intronic
1181433877 22:22899197-22899219 GCCCCTCTCCTCCCATGCAGAGG - Intergenic
1184610310 22:45599126-45599148 GCTCCTCTTCTACCCTGCCGTGG + Intronic
1184677201 22:46050210-46050232 GAGCCTCCCCTCCACTGCGGAGG - Exonic
954419546 3:50411402-50411424 GCCCCTCCCCTCCACTCTGGTGG - Intronic
959599598 3:108165779-108165801 GCCCCTCTCCTAAACTGTTTAGG - Intronic
961698709 3:128725306-128725328 GCCCCTCTCCTGCCCTGCTCAGG + Intergenic
961810399 3:129518669-129518691 GCCCCTCTCCCACAGTGGTGGGG - Intronic
968689931 4:1985121-1985143 TCCCCTCTCCTACACAGGAGCGG - Intronic
970536789 4:17038196-17038218 GCAACTCTCCTCCAATGCGGAGG - Intergenic
975174597 4:71273273-71273295 GCCCCTCTTCTTCACTGTGGGGG + Intronic
978378258 4:108098142-108098164 GCCTCTCTCCTCCACTGCCCAGG + Intronic
994551329 5:101238933-101238955 GCCACTGTGCTACACTGCTGGGG + Intergenic
996304611 5:122032882-122032904 GCCTCTGTCATACACTGCAGTGG - Intronic
997645341 5:135477936-135477958 GCCCCCCTCCTGCACTGCCCAGG + Intergenic
997677767 5:135726166-135726188 GCCCTGCTGCTACACTGCTGGGG - Intergenic
998139918 5:139693949-139693971 GGCCCTCTCCTGCCCTGCAGTGG + Intergenic
998890725 5:146742938-146742960 GCCCCTCTCCTAGCCTCCTGTGG - Intronic
1002591082 5:180291992-180292014 GCCCCTCACACCCACTGCGGCGG - Exonic
1002603202 5:180366641-180366663 GGCACTCTCATACACTGCTGGGG + Intergenic
1006485174 6:34334005-34334027 GCCCCCCTCTTCCACTGCGGAGG - Intronic
1011054912 6:83193902-83193924 GCCCCCCCCCAACACCGCGGTGG - Exonic
1018170136 6:161138004-161138026 GCCCCTCTCCAAGACGGCGTGGG + Intronic
1018399098 6:163404689-163404711 TTCACTCTCCTACACTGCTGCGG + Intergenic
1020099627 7:5387899-5387921 GCCCGTCTCCCACACTCCGGAGG - Exonic
1020451289 7:8323264-8323286 TCCCCTTTCCTCCACTGAGGTGG - Intergenic
1023654896 7:42409485-42409507 TACCCTCCCCTACACTGCAGAGG - Intergenic
1024173956 7:46819275-46819297 GCCCCTATCCTTCCCTGCAGGGG + Intergenic
1025603543 7:63022789-63022811 GCCCCTCTCCTTCCCTGCAGTGG + Intergenic
1027819307 7:83023776-83023798 GCTCCTCTTCTGCACTGTGGTGG - Intronic
1034669627 7:152848250-152848272 GCCCCTCTCCTACACTGCGGTGG + Intronic
1036645432 8:10609195-10609217 GCCCCTCTCCTTCACCCTGGAGG - Exonic
1036781669 8:11651918-11651940 GCCCCTCTCCTTTCCTGCAGTGG - Intergenic
1040107661 8:43549615-43549637 GCCCCCCACCCACACTGGGGTGG + Intergenic
1053181199 9:35971999-35972021 CTCCATCTCCTACACTGCGAAGG + Intergenic
1057140330 9:92722843-92722865 GCCCCTCTCGTGCCCTGTGGAGG - Intronic
1058467633 9:105244891-105244913 GCCCCTCACCTGCGCGGCGGAGG - Exonic
1060668478 9:125447811-125447833 GCCCTCCTCCAAAACTGCGGAGG - Intronic
1061041734 9:128144654-128144676 GCCCCTCTGGTGCCCTGCGGGGG - Intergenic
1062502588 9:136857783-136857805 GCCCCTCACCTGGGCTGCGGAGG - Exonic
1187124423 X:16440639-16440661 GACACTCTCCTACACAGCAGTGG + Intergenic
1197755869 X:129994242-129994264 ACCCATAGCCTACACTGCGGTGG - Intronic