ID: 1034670238

View in Genome Browser
Species Human (GRCh38)
Location 7:152852261-152852283
Sequence AGAGGCCTCCACGCAGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034670238 Original CRISPR AGAGGCCTCCACGCAGTGCC TGG Intronic
901183549 1:7357810-7357832 AAAGGACTCCATGCAGTGTCTGG + Intronic
906511613 1:46413344-46413366 AGAGGCCACAACGTAGGGCCAGG - Intronic
907337748 1:53711297-53711319 AGAGGCTTCCATGCAGGGCAAGG - Intronic
908766446 1:67558924-67558946 AGAGGTATCCAAGCAGAGCCTGG + Intergenic
912419442 1:109533042-109533064 AGAGCACTCCCAGCAGTGCCTGG - Intergenic
914224282 1:145707553-145707575 AGCGGCCTCCCCGCAGGGCCAGG - Intronic
915238041 1:154500359-154500381 ACAGCTCTCCACTCAGTGCCTGG + Intronic
915327464 1:155087716-155087738 AGGGGCCTCCAGGCAGGGCCTGG + Intergenic
916465567 1:165071305-165071327 AGAGGACTCACCTCAGTGCCTGG + Intergenic
916481916 1:165221703-165221725 AGAGGCATCCAGGCCGTGGCGGG - Intronic
916606033 1:166343213-166343235 AGATGCCTCCCCGCAGGGCAGGG - Intergenic
919687866 1:200501069-200501091 GGAGGCATCCACTCAATGCCAGG - Intergenic
920046697 1:203137363-203137385 AGTGGCCTCCATGCTGTACCTGG - Intronic
924048828 1:240060127-240060149 CTAGGACCCCACGCAGTGCCTGG - Intronic
1063476976 10:6337453-6337475 AGAGGCTGCCACTCAGTTCCGGG + Intergenic
1063979351 10:11441246-11441268 AGGGGGCTGCACGCGGTGCCAGG + Intergenic
1065434663 10:25694410-25694432 ACAGGCCTCCCAGCATTGCCTGG - Intergenic
1067071546 10:43136562-43136584 AGAGACCTCCACGCAGAGTGAGG + Intergenic
1069692395 10:70362661-70362683 AGCTGACTCCACCCAGTGCCAGG + Intronic
1069823936 10:71243850-71243872 AAGGTCCTTCACGCAGTGCCTGG - Intronic
1071845907 10:89520909-89520931 ATAAGCCTCCAGCCAGTGCCTGG + Intronic
1072699413 10:97629680-97629702 AGAGGCCTCCCCATGGTGCCAGG + Intronic
1073009749 10:100349863-100349885 AGAGGCATCCACAGACTGCCTGG - Intronic
1073489595 10:103844241-103844263 TGAGCCCTCAGCGCAGTGCCTGG - Intronic
1073761524 10:106633840-106633862 AGAGGCCTCAAAACAGTGCTGGG - Intronic
1074355845 10:112782370-112782392 AAGGGCCTTCACGCAGGGCCTGG - Intronic
1074364371 10:112846070-112846092 AGAGGGCTCGAGGCAGAGCCTGG + Intergenic
1074874372 10:117602720-117602742 AGGAGGCTCCACGCAGGGCCTGG - Intergenic
1075656685 10:124166549-124166571 AGAGGCTGCAATGCAGTGCCAGG + Intergenic
1075726291 10:124612555-124612577 AGAGGCCTCCGGGCCCTGCCAGG - Intronic
1076334095 10:129693518-129693540 AGAAGCCTCCACCTACTGCCTGG - Intronic
1076409397 10:130235000-130235022 GGAGGACTCCATGCAGTGGCTGG - Intergenic
1076994369 11:290966-290988 AGAGGGAGCCACGCAGGGCCTGG - Exonic
1077406866 11:2386641-2386663 TGAGGCCTCTGCCCAGTGCCTGG + Intronic
1079244649 11:18743512-18743534 AGGAGCCTCCATGCAGGGCCAGG - Intronic
1083325698 11:61871965-61871987 AGAGGCCTCCTGGTAGGGCCAGG - Intergenic
1083674292 11:64316935-64316957 AGAGGGCACCCTGCAGTGCCCGG - Exonic
1084160771 11:67348740-67348762 AGAGCCCTCCCAGCAGTGTCAGG + Intronic
1084460719 11:69295135-69295157 AGAGGCCGCCGCTCTGTGCCTGG - Intronic
1084674240 11:70624848-70624870 AAATGCCTCCACCCAGAGCCTGG + Intronic
1085026384 11:73239066-73239088 AAAGTCCTCCTCACAGTGCCTGG + Intergenic
1088170580 11:106991891-106991913 AGAGGGCTTAAAGCAGTGCCTGG - Intronic
1091587476 12:1824491-1824513 CCAGGCCTCCACGGAGTCCCTGG - Intronic
1093894395 12:24561207-24561229 AGAGCCCTACACTCGGTGCCAGG - Intergenic
1097688031 12:62709334-62709356 AGAAGCCTCCCTGCTGTGCCAGG - Intronic
1103237664 12:119386823-119386845 AGAGGCTTCCTCGCAATGCTCGG - Intronic
1104739898 12:131164695-131164717 GGAGGCCTGAACGCAGTGTCTGG - Intergenic
1104747583 12:131219826-131219848 AGGGGCCTCCGAGCAGAGCCTGG + Intergenic
1104906322 12:132215370-132215392 AGTGGCATCCAGGCGGTGCCGGG - Intronic
1106433955 13:29707814-29707836 AAGGGCCTGCACACAGTGCCTGG - Intergenic
1106593772 13:31120121-31120143 GGCGGCCACCACTCAGTGCCAGG + Intergenic
1108687379 13:52832467-52832489 AGGTGCCTACAGGCAGTGCCAGG + Intergenic
1112917257 13:104566940-104566962 ACAGGGCTCCACATAGTGCCAGG + Intergenic
1113008271 13:105733320-105733342 AGAGGCAGCCACGCAGTGGCAGG - Intergenic
1119670435 14:76514250-76514272 AGAGGGCTCCTCTCAGTGGCAGG + Intergenic
1122254126 14:100464206-100464228 AGAAGCTTCCAGGCAGTGACAGG - Intronic
1122482124 14:102054141-102054163 AAAGCCCTCAACGCAGTGCTGGG + Intergenic
1122809327 14:104280290-104280312 AGAGGGCTCCAAGCAGAGGCTGG + Intergenic
1126780218 15:52133410-52133432 AAAGGCCTGCACGCACTGGCCGG + Exonic
1127191345 15:56534102-56534124 AGCTGCCTCCATGCAGTGCTGGG - Intergenic
1128324939 15:66718262-66718284 AGAGGCCTCCTGACAGTGCTTGG - Intronic
1129605662 15:77023817-77023839 AGAGGCCTCCAGGCACAGCGTGG - Intronic
1131053952 15:89364798-89364820 AGGTGCCTCCACGGAGGGCCTGG - Intergenic
1132664784 16:1076353-1076375 AGTGGCCTCCACGCAGACCCCGG - Intergenic
1134189904 16:12112970-12112992 AGAGTCCACCACGCTGTCCCAGG - Intronic
1134196549 16:12163463-12163485 AGAGGCCTGCACACCATGCCTGG + Intronic
1134553163 16:15147471-15147493 AGAGGGCTCAGCGCAGGGCCCGG + Intergenic
1134603397 16:15550982-15551004 AGAGGACGCCACACAGTGGCAGG + Intronic
1135470436 16:22724586-22724608 AGGTTCCTCCACGCAGTTCCGGG + Intergenic
1135852011 16:25972355-25972377 GGAGGCCTACAAGTAGTGCCTGG - Intronic
1136026233 16:27470789-27470811 AGCTGTCTCCACGCAGTGCCTGG + Intronic
1136612083 16:31372373-31372395 AGAGTCCTCCACGCAGCTCTGGG - Exonic
1141174226 16:81708632-81708654 AGGGGCCTCTGCTCAGTGCCAGG + Intronic
1142119705 16:88379876-88379898 AGAGTCCTTCACACAGTGACTGG + Intergenic
1142432888 16:90040101-90040123 AGAGCCATCCACGCAGTGGAAGG - Intronic
1142707919 17:1708300-1708322 AGAGGCTTCCACGCAGTCTGTGG + Intronic
1143233659 17:5379340-5379362 AGATGTCCCCGCGCAGTGCCGGG + Intronic
1147932033 17:43987710-43987732 ACTGGCCTCCTCTCAGTGCCTGG - Intronic
1148853570 17:50566528-50566550 AGAGGCCTCCAGTCTGAGCCTGG + Intronic
1152204983 17:78969850-78969872 AGAGGCCTCCATCCAGTACAGGG + Intergenic
1152242330 17:79167182-79167204 AGAGACTTCCAGACAGTGCCAGG + Intronic
1152282762 17:79395219-79395241 AGAGGCCGCCACACATTGCTGGG - Intronic
1154151319 18:11908624-11908646 AGCGCCCTCCGCGAAGTGCCTGG + Exonic
1155172997 18:23280919-23280941 GGAGTCCTCCACGCAGGGCATGG - Intronic
1158701252 18:59749589-59749611 AAAGTCCTTCACACAGTGCCTGG + Intergenic
1160228727 18:77030379-77030401 CGAGGCCTCCACACAGGGACGGG + Intronic
1160286120 18:77545079-77545101 AGAGGCCCCCACGGACTGGCTGG - Intergenic
1160577983 18:79867804-79867826 AGGGGTCTCCACGCAGTCCAGGG - Intronic
1160843982 19:1158672-1158694 AGAGGCCACCGCACAGTCCCTGG + Intronic
1160867974 19:1264405-1264427 AGACAGCTCCACGCAGCGCCAGG - Intronic
1161656919 19:5522049-5522071 ATAGGCCTAGACGCAGTGCCAGG + Intergenic
1162499095 19:11041232-11041254 AGAGGCCGCGACGCAATCCCAGG - Intronic
1163019214 19:14473702-14473724 AGAGGCCAGCAAGCAGTGCCTGG + Exonic
1164769539 19:30797653-30797675 AGTGCCCTCCACGTTGTGCCAGG + Intergenic
1164821756 19:31256198-31256220 AGAGGAATCCACTCAGGGCCTGG + Intergenic
1166227556 19:41406063-41406085 AAAGGGCTCCACGCTGTGCCTGG - Intronic
1166336223 19:42109281-42109303 AGAGGCCTCCACACAATCTCTGG + Intronic
926247531 2:11132131-11132153 AGAGGCCTGCGCAGAGTGCCCGG - Intergenic
927793362 2:26028279-26028301 AGAGGGCACCCTGCAGTGCCCGG - Intergenic
930093768 2:47551245-47551267 AGAGGGCTCCAGCCAGTGCCAGG - Intronic
932692727 2:73926998-73927020 AGAGGCCTGCACGCGGGGCGCGG + Exonic
935619826 2:105119231-105119253 CGAGGCCTCCATGCAGCCCCAGG + Intergenic
937022705 2:118672905-118672927 AGAGGTCTCCATGCTGTACCAGG + Intergenic
937505380 2:122530917-122530939 AGAAGCCATCAAGCAGTGCCTGG - Intergenic
938406759 2:131037107-131037129 AGAGGCCTCCACGGGGTCCCAGG - Intronic
940816671 2:158304789-158304811 AGATGCCTCCAAGGAGAGCCAGG + Intronic
945192994 2:207209308-207209330 GGAGGCCCTCACACAGTGCCTGG - Intergenic
945951705 2:216045006-216045028 AAAGGCCCCCAGGCAGGGCCAGG + Intronic
947742030 2:232489033-232489055 AGAGGCCGGCACTCAGGGCCAGG - Intergenic
948785606 2:240350914-240350936 AGAGGGAGCCACACAGTGCCCGG + Intergenic
1168860469 20:1042884-1042906 AGAGCCCTCAGCACAGTGCCTGG - Intergenic
1171460537 20:25295625-25295647 TGAAGCCTACATGCAGTGCCAGG + Exonic
1171823630 20:29876257-29876279 AGAGGCCTCCATCCACTGCCAGG - Intergenic
1171896459 20:30814088-30814110 AGAGGCCTCCATCCCCTGCCAGG + Intergenic
1175073800 20:56357171-56357193 AAAGGGCTTCACTCAGTGCCTGG - Intergenic
1175661520 20:60816981-60817003 AGAGGATTCCACACAGTGACAGG - Intergenic
1176168381 20:63686211-63686233 TGCTGCCTCCACGCAGCGCCTGG + Intronic
1178497846 21:33101943-33101965 TGGGGCCTCCCCGCAGAGCCTGG - Intergenic
1178596884 21:33962396-33962418 AGAGGCTTCCTAGCAGTACCAGG - Intergenic
1179799244 21:43803194-43803216 ACAGGACGCCAGGCAGTGCCAGG - Intronic
1179810198 21:43865229-43865251 TGAGGCCCCGACGCAGGGCCGGG + Intronic
1179904207 21:44413793-44413815 CGAGGCCTCCAGTCACTGCCAGG - Intronic
1181466259 22:23112255-23112277 AGAGACCCCCAGGCAGGGCCTGG - Intronic
1183784645 22:40022383-40022405 AGAGCCCTCAACTCAGAGCCAGG - Intronic
1184254550 22:43279720-43279742 ACAGCCCTCCACGCACTGTCTGG + Intronic
1184828288 22:46968102-46968124 AGAGGCACCCACGCACTGCGTGG + Intronic
1184828310 22:46968219-46968241 AGAGGCCTCCATGCTGTGCGGGG + Intronic
949188078 3:1218098-1218120 AGAGGCATCCATGCAGGGCAGGG + Intronic
950097933 3:10340766-10340788 AGAGGCCCCCACGAAAGGCCAGG - Intronic
951547359 3:23840694-23840716 AGAGGACACTACGCAATGCCAGG - Intronic
953388815 3:42522830-42522852 AGGATCCTCCACTCAGTGCCTGG - Intronic
954155514 3:48682904-48682926 GGAGGACTCCACGCTGTTCCAGG + Exonic
954463944 3:50643786-50643808 AGAGACCCCCAAGCAGAGCCGGG - Intronic
954627932 3:52032896-52032918 AGAGGGCTGAACGCAGAGCCAGG - Intergenic
955286534 3:57646976-57646998 ACAGGCCTCCACCCAATTCCAGG - Intronic
956744247 3:72298954-72298976 GGAGGCCTCCCAGCTGTGCCAGG - Intergenic
957079475 3:75623906-75623928 AGAGCCCTCCCCGCAGCGCGGGG + Intergenic
961104548 3:124230071-124230093 AGAGGCCACTGAGCAGTGCCAGG + Intronic
961408715 3:126703317-126703339 AGAAGCCTACACACAATGCCTGG + Intergenic
961454730 3:127018272-127018294 AGTGGCCTCCACCCACTGGCAGG + Exonic
961531586 3:127543590-127543612 AGAGGCCTGCACGGAGTGCCGGG - Intergenic
963926183 3:150953572-150953594 AGTGGGCTCCACCCACTGCCTGG - Intronic
968564681 4:1305226-1305248 AAAGGTCTCCACACATTGCCAGG + Intronic
969402754 4:6967850-6967872 AGAGGCATCCCAGCAGAGCCGGG - Intronic
969673185 4:8601029-8601051 AGGGGACCCCACGCAGGGCCAGG - Intronic
970300119 4:14672362-14672384 AGAGGACTCCACATAGAGCCAGG + Intergenic
978063290 4:104364842-104364864 AGAGGCCTCCACGGGGAGACAGG - Intergenic
979104339 4:116664997-116665019 AAAGGGCTCCACCCAGTGACTGG + Intergenic
981090989 4:140731978-140732000 ACAGGCTTCCACGCAGGGCTGGG - Intronic
981923785 4:150116375-150116397 AGAGGCATAGGCGCAGTGCCGGG - Intronic
982303187 4:153900955-153900977 GGAGCCCTTCACTCAGTGCCAGG - Intergenic
985105865 4:186499702-186499724 AGAGGGCTTCAAGCAGTGTCTGG - Intronic
985359191 4:189154649-189154671 AGGGGCCTCCACGGACTCCCAGG - Intergenic
985632020 5:1018738-1018760 AGATGCCTCCAAGCAAGGCCTGG - Intronic
995658798 5:114457758-114457780 GGAGACCTCCAGGCAGTGCCAGG + Intronic
995805380 5:116046550-116046572 TGAGGCCTCCACACCTTGCCAGG + Intronic
997929949 5:138064297-138064319 AAAGCCCTCAACACAGTGCCTGG - Intergenic
1000351904 5:160358766-160358788 ACAGGGCTTCACACAGTGCCTGG - Intronic
1001149638 5:169216085-169216107 AGAGACCCTCACTCAGTGCCTGG + Intronic
1001297895 5:170511619-170511641 TCTGGCCTCCACCCAGTGCCAGG + Intronic
1003048924 6:2763463-2763485 AGTTGCCTCCACGCAGCGCAAGG - Intergenic
1004204020 6:13574750-13574772 AGCGACCCCCACGCAGAGCCCGG - Intronic
1005281923 6:24283654-24283676 ACACCCCTCCTCGCAGTGCCAGG + Intronic
1005385325 6:25279550-25279572 TGACGCCTCCTCGCAGTTCCCGG - Exonic
1005404368 6:25470343-25470365 AGAGGGCTTAACTCAGTGCCTGG + Intronic
1005649458 6:27873378-27873400 TAACGCCTCCACGCCGTGCCAGG + Exonic
1006125232 6:31833602-31833624 CTAGGCCTCCACAAAGTGCCAGG - Intergenic
1006825641 6:36933487-36933509 GGAAACCTCCACTCAGTGCCAGG + Intergenic
1007383040 6:41502952-41502974 CCAGGCCACCAGGCAGTGCCAGG + Intergenic
1013574999 6:111474031-111474053 GGAGGCATCTACACAGTGCCTGG + Intronic
1016657924 6:146543326-146543348 AGAGGCTTCCAGGCTGGGCCCGG + Intergenic
1018919210 6:168159731-168159753 TGAGGCCTGCACGGAGTGTCAGG + Intergenic
1022027837 7:26465372-26465394 AGAGGCAACCAGGCAGTGGCTGG + Intergenic
1023288743 7:38646840-38646862 AGAGGCCACCATGCTCTGCCTGG - Intergenic
1025596342 7:62931805-62931827 ATAGGCCTCCATGCACTCCCAGG + Intergenic
1029957398 7:104653900-104653922 AGCAGCCTCCACGCAGAACCAGG + Intronic
1030302430 7:107987836-107987858 AGCCGCCTCCACCCACTGCCTGG - Intronic
1031922234 7:127610912-127610934 AGAGGCATCGAGGCAGGGCCAGG + Exonic
1033051409 7:138007530-138007552 AGCAGCCTCCACACAGTGACAGG - Intronic
1033312411 7:140271483-140271505 AGCGGCCTCCCCGCAGGGCAGGG - Intergenic
1033681192 7:143598349-143598371 AGTGGCCTCCTCGCAGTGGGGGG + Intergenic
1033703699 7:143863464-143863486 AGTGGCCTCCTCGCAGTGGGGGG - Exonic
1034501760 7:151455250-151455272 AGCGGGCACCCCGCAGTGCCAGG + Intergenic
1034670238 7:152852261-152852283 AGAGGCCTCCACGCAGTGCCTGG + Intronic
1035274689 7:157740637-157740659 AGAGGGCTCCAAGGAGTGGCGGG + Intronic
1036770912 8:11577884-11577906 CCAGGCCTGCACTCAGTGCCGGG - Intergenic
1037889684 8:22617304-22617326 AGAGCCCTCCATACAGTGCCTGG + Intronic
1040973937 8:53169443-53169465 ATATGACTCCACCCAGTGCCAGG - Intergenic
1042325978 8:67528324-67528346 AGAGGCTTCCATGCAGAGGCTGG + Intronic
1047211537 8:122844184-122844206 AAAGGCCTCCACGCAGAGCTTGG + Intronic
1048199029 8:132356138-132356160 TGGAGCCTCCACTCAGTGCCTGG - Intronic
1048335558 8:133499658-133499680 AAAGGCCTTAACCCAGTGCCAGG - Intronic
1048924459 8:139259067-139259089 AGGGGCATCCAGACAGTGCCTGG - Intergenic
1050509944 9:6384005-6384027 AAAGGGCCCCACCCAGTGCCTGG - Intergenic
1053000373 9:34574401-34574423 ATAGGGCTCCAAGCTGTGCCTGG + Intronic
1053312433 9:37027970-37027992 AAAGGGGCCCACGCAGTGCCTGG + Intronic
1053749092 9:41235401-41235423 AGAGGCCTCCATCCCCTGCCAGG + Intergenic
1054336773 9:63815348-63815370 AGAGGCCTCCATCCCCTGCCAGG - Intergenic
1060550922 9:124485115-124485137 AGAGGCCTGCAAGCTGTGACAGG - Intronic
1061243189 9:129386315-129386337 AGAGCCCTCGGCACAGTGCCAGG + Intergenic
1061597450 9:131641130-131641152 AGTGACCTCCAAGCAGAGCCTGG + Intronic
1061707017 9:132461109-132461131 AAAGCCCTCCGCACAGTGCCTGG + Intronic
1061842142 9:133365001-133365023 ACAGGCCTCCTCCCAGGGCCAGG + Exonic
1062029787 9:134356997-134357019 AGAGGCCCCCAGGCAGAGCCGGG + Intronic
1062171150 9:135135547-135135569 AGAGGCCAGCATGCAGTGCTGGG + Intergenic
1062262426 9:135669665-135669687 AGAGGCCACCAGCCAGTGCCAGG - Intergenic
1062421702 9:136485534-136485556 AGAGGCCTCCACCCAGTGCTGGG + Exonic
1062514529 9:136925957-136925979 AGGGGCCACCACGCTGGGCCAGG + Exonic
1187282155 X:17865776-17865798 AGAGGCTTCAATGCAGTGCAGGG - Intergenic
1194438101 X:93894415-93894437 AAAGCCCTCCACGTAGTACCTGG + Intergenic
1195585733 X:106563546-106563568 AGAGACCTCCACCCAGCCCCTGG - Intergenic
1198138461 X:133778722-133778744 AGAGTCATCCAGGCAGTCCCAGG - Intronic
1199719829 X:150535094-150535116 AAAGGCCTCAACGAGGTGCCAGG - Intergenic
1199764905 X:150934489-150934511 AGAGGTGTCCAAGCAGAGCCTGG + Intergenic
1200067377 X:153510303-153510325 AGGAGCCAACACGCAGTGCCAGG - Intergenic
1200208219 X:154332883-154332905 CGAGGCCTCCTCGCCCTGCCAGG + Intergenic
1201065026 Y:10089162-10089184 AGAGGCCTCCATCCCCTGCCAGG + Intergenic
1201944587 Y:19497995-19498017 TGATGCCTCCATGAAGTGCCTGG + Intergenic