ID: 1034671144

View in Genome Browser
Species Human (GRCh38)
Location 7:152859324-152859346
Sequence CTTGGTATGTAACGTGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034671135_1034671144 14 Left 1034671135 7:152859287-152859309 CCATGGGGAGCTGGAAATCCCCC No data
Right 1034671144 7:152859324-152859346 CTTGGTATGTAACGTGTTCCAGG No data
1034671137_1034671144 -5 Left 1034671137 7:152859306-152859328 CCCCTCGAATCCAGATCCCTTGG No data
Right 1034671144 7:152859324-152859346 CTTGGTATGTAACGTGTTCCAGG No data
1034671139_1034671144 -6 Left 1034671139 7:152859307-152859329 CCCTCGAATCCAGATCCCTTGGT No data
Right 1034671144 7:152859324-152859346 CTTGGTATGTAACGTGTTCCAGG No data
1034671140_1034671144 -7 Left 1034671140 7:152859308-152859330 CCTCGAATCCAGATCCCTTGGTA No data
Right 1034671144 7:152859324-152859346 CTTGGTATGTAACGTGTTCCAGG No data
1034671136_1034671144 -4 Left 1034671136 7:152859305-152859327 CCCCCTCGAATCCAGATCCCTTG No data
Right 1034671144 7:152859324-152859346 CTTGGTATGTAACGTGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034671144 Original CRISPR CTTGGTATGTAACGTGTTCC AGG Intergenic
No off target data available for this crispr