ID: 1034672266

View in Genome Browser
Species Human (GRCh38)
Location 7:152867714-152867736
Sequence GAAAAGTGGAAGTTTGAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034672264_1034672266 2 Left 1034672264 7:152867689-152867711 CCATTTGTGTATTCAGTCTCATT No data
Right 1034672266 7:152867714-152867736 GAAAAGTGGAAGTTTGAATAAGG No data
1034672263_1034672266 9 Left 1034672263 7:152867682-152867704 CCATTGTCCATTTGTGTATTCAG No data
Right 1034672266 7:152867714-152867736 GAAAAGTGGAAGTTTGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034672266 Original CRISPR GAAAAGTGGAAGTTTGAATA AGG Intergenic
No off target data available for this crispr