ID: 1034672267

View in Genome Browser
Species Human (GRCh38)
Location 7:152867719-152867741
Sequence GTGGAAGTTTGAATAAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034672264_1034672267 7 Left 1034672264 7:152867689-152867711 CCATTTGTGTATTCAGTCTCATT No data
Right 1034672267 7:152867719-152867741 GTGGAAGTTTGAATAAGGTGTGG No data
1034672263_1034672267 14 Left 1034672263 7:152867682-152867704 CCATTGTCCATTTGTGTATTCAG No data
Right 1034672267 7:152867719-152867741 GTGGAAGTTTGAATAAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034672267 Original CRISPR GTGGAAGTTTGAATAAGGTG TGG Intergenic
No off target data available for this crispr