ID: 1034672279

View in Genome Browser
Species Human (GRCh38)
Location 7:152867889-152867911
Sequence GGTTCCTGATGGTGGCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034672274_1034672279 17 Left 1034672274 7:152867849-152867871 CCTTTCTACCATATCACACATTT No data
Right 1034672279 7:152867889-152867911 GGTTCCTGATGGTGGCCTTGTGG No data
1034672273_1034672279 26 Left 1034672273 7:152867840-152867862 CCTTCAATGCCTTTCTACCATAT No data
Right 1034672279 7:152867889-152867911 GGTTCCTGATGGTGGCCTTGTGG No data
1034672275_1034672279 9 Left 1034672275 7:152867857-152867879 CCATATCACACATTTTTCTTTAA No data
Right 1034672279 7:152867889-152867911 GGTTCCTGATGGTGGCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034672279 Original CRISPR GGTTCCTGATGGTGGCCTTG TGG Intergenic
No off target data available for this crispr