ID: 1034672452

View in Genome Browser
Species Human (GRCh38)
Location 7:152868970-152868992
Sequence CCCATCAGTTCCCAGGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034672452_1034672461 28 Left 1034672452 7:152868970-152868992 CCTGTTTCCTGGGAACTGATGGG No data
Right 1034672461 7:152869021-152869043 AGTGTTGACCGGCCAATTCTGGG No data
1034672452_1034672460 27 Left 1034672452 7:152868970-152868992 CCTGTTTCCTGGGAACTGATGGG No data
Right 1034672460 7:152869020-152869042 GAGTGTTGACCGGCCAATTCTGG No data
1034672452_1034672459 17 Left 1034672452 7:152868970-152868992 CCTGTTTCCTGGGAACTGATGGG No data
Right 1034672459 7:152869010-152869032 AGGTTGACTTGAGTGTTGACCGG No data
1034672452_1034672455 -3 Left 1034672452 7:152868970-152868992 CCTGTTTCCTGGGAACTGATGGG No data
Right 1034672455 7:152868990-152869012 GGGTACCCTCAGTGCTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034672452 Original CRISPR CCCATCAGTTCCCAGGAAAC AGG (reversed) Intergenic
No off target data available for this crispr