ID: 1034674345

View in Genome Browser
Species Human (GRCh38)
Location 7:152881861-152881883
Sequence CTCTGCTCCTTGCGGTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034674339_1034674345 -6 Left 1034674339 7:152881844-152881866 CCATGAACCCCAGGGTCCTCTGC No data
Right 1034674345 7:152881861-152881883 CTCTGCTCCTTGCGGTGTCCTGG No data
1034674336_1034674345 13 Left 1034674336 7:152881825-152881847 CCAGGGATGCTCAGAGCTTCCAT No data
Right 1034674345 7:152881861-152881883 CTCTGCTCCTTGCGGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034674345 Original CRISPR CTCTGCTCCTTGCGGTGTCC TGG Intergenic
No off target data available for this crispr