ID: 1034675228

View in Genome Browser
Species Human (GRCh38)
Location 7:152888069-152888091
Sequence TCGAGTTCACAGGTGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034675228_1034675233 -5 Left 1034675228 7:152888069-152888091 CCTGCAGCCACCTGTGAACTCGA No data
Right 1034675233 7:152888087-152888109 CTCGATCCCAGAGCAGCCTGGGG No data
1034675228_1034675237 11 Left 1034675228 7:152888069-152888091 CCTGCAGCCACCTGTGAACTCGA No data
Right 1034675237 7:152888103-152888125 CCTGGGGTTCTTTGAAAGAGAGG No data
1034675228_1034675238 12 Left 1034675228 7:152888069-152888091 CCTGCAGCCACCTGTGAACTCGA No data
Right 1034675238 7:152888104-152888126 CTGGGGTTCTTTGAAAGAGAGGG No data
1034675228_1034675231 -7 Left 1034675228 7:152888069-152888091 CCTGCAGCCACCTGTGAACTCGA No data
Right 1034675231 7:152888085-152888107 AACTCGATCCCAGAGCAGCCTGG No data
1034675228_1034675232 -6 Left 1034675228 7:152888069-152888091 CCTGCAGCCACCTGTGAACTCGA No data
Right 1034675232 7:152888086-152888108 ACTCGATCCCAGAGCAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034675228 Original CRISPR TCGAGTTCACAGGTGGCTGC AGG (reversed) Intergenic
No off target data available for this crispr