ID: 1034676236

View in Genome Browser
Species Human (GRCh38)
Location 7:152894567-152894589
Sequence AGTGGGGGGCGCGCGCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034676236_1034676240 -8 Left 1034676236 7:152894567-152894589 CCAGAGGGCGCGCGCCCCCCACT No data
Right 1034676240 7:152894582-152894604 CCCCCACTCCTGCCCGCGTCGGG No data
1034676236_1034676242 -7 Left 1034676236 7:152894567-152894589 CCAGAGGGCGCGCGCCCCCCACT No data
Right 1034676242 7:152894583-152894605 CCCCACTCCTGCCCGCGTCGGGG No data
1034676236_1034676238 -9 Left 1034676236 7:152894567-152894589 CCAGAGGGCGCGCGCCCCCCACT No data
Right 1034676238 7:152894581-152894603 CCCCCCACTCCTGCCCGCGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034676236 Original CRISPR AGTGGGGGGCGCGCGCCCTC TGG (reversed) Intergenic
No off target data available for this crispr