ID: 1034676923

View in Genome Browser
Species Human (GRCh38)
Location 7:152898598-152898620
Sequence CTGTAGCCAGAGAGTGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034676913_1034676923 30 Left 1034676913 7:152898545-152898567 CCTTGTACAGAGAGGCAAAGACA No data
Right 1034676923 7:152898598-152898620 CTGTAGCCAGAGAGTGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034676923 Original CRISPR CTGTAGCCAGAGAGTGGGGA TGG Intergenic
No off target data available for this crispr