ID: 1034686034

View in Genome Browser
Species Human (GRCh38)
Location 7:152972313-152972335
Sequence GCTCTCAGGCTGTGCCCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034686034_1034686041 29 Left 1034686034 7:152972313-152972335 CCTAGGGGGCACAGCCTGAGAGC No data
Right 1034686041 7:152972365-152972387 GAAGGCACACTGTCTCTTCCTGG No data
1034686034_1034686040 11 Left 1034686034 7:152972313-152972335 CCTAGGGGGCACAGCCTGAGAGC No data
Right 1034686040 7:152972347-152972369 AAGGATATGAGAGTCGGAGAAGG No data
1034686034_1034686038 -8 Left 1034686034 7:152972313-152972335 CCTAGGGGGCACAGCCTGAGAGC No data
Right 1034686038 7:152972328-152972350 CTGAGAGCACAGAGGCAGGAAGG No data
1034686034_1034686039 5 Left 1034686034 7:152972313-152972335 CCTAGGGGGCACAGCCTGAGAGC No data
Right 1034686039 7:152972341-152972363 GGCAGGAAGGATATGAGAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034686034 Original CRISPR GCTCTCAGGCTGTGCCCCCT AGG (reversed) Intergenic
No off target data available for this crispr