ID: 1034686038

View in Genome Browser
Species Human (GRCh38)
Location 7:152972328-152972350
Sequence CTGAGAGCACAGAGGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034686034_1034686038 -8 Left 1034686034 7:152972313-152972335 CCTAGGGGGCACAGCCTGAGAGC No data
Right 1034686038 7:152972328-152972350 CTGAGAGCACAGAGGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034686038 Original CRISPR CTGAGAGCACAGAGGCAGGA AGG Intergenic
No off target data available for this crispr